The RNA polymerase Pol III uniquely transcribes small noncoding RNAs, including 5S rRNAs (type 1), tRNAs (type 2), and a number of other small RNAs (type 3), such as U6 snRNA. Pol III promoters can be divided into three types: type 1 and type 2 and type 3.
Pol III promoters can be categorized into three types: type 1, type 2, and type 3. Type 1 and type 2 promoters are located downstream of the transcription start point, where they transcribe 5S rRNAs and tRNAs, respectively, and type 3 promoters are located upstream of the transcription start point.
The type 1 promoter downstream of the transcription start contains two core elements, boxA and boxC; the type 2 promoter downstream of the transcription start contains two core elements, boxA and boxB; while the type 3 promoter upstream of the transcription start consists of three core elements, PSE (proximal sequence element), OCT (octamer motif), and the TATA box.
This article mainly introduces the sequences of the three type 3 Pol III promoters 7SK, U6 and H1 promoters, the transcription start sites and some of their characteristics.
The bold part is the TATA box, and the green background is the +1 position.
The sequence of human 7SK promoter:
CTGCAGTATTTAGCATGCCCCACCCATCTGCAAGGCATTCTGGATAGTGTCAAAACAGCCGGAAATCAAGTCCGTTTATCTCAAACTTTAGCATTTTGGGAATAAATGATATTTGCTATGCTGGTTAAATTAGATTTTAGTTAAATTTCCTGCTGAAGCTCTAGTACGATAAGTAACTTGACCTAAGTGTAAAGTTGAGATTTCCTTCAGGTTTATATAGCTTGTGCGCCGCCTGGGTACCTCG
The putative transcription start point (+1) of h7SK promoter is 24 nt away from the TATA box. Researchers investigated and found that the 7SK promoter +1 position of 14 vertebrate species in the NCBI database are all G. When the transcription start point is G or A, the transcriptional activity is twice that of T or C. When the +1 position is G, the transcription starts from +1; when the +1 position is A, the vast majority (98.5%) starts from +1; when the +1 position is A, only a small portion starts from -1; when the +1 position is C or T, most of the transcription start point becomes -1.
The sequence of human U6 promoter:
GAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATACGATACAAGGCTGTTAGAGAGATAATTGGAATTAATTTGACTGTAAACACAAAGATATTAGTACAAAATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGTTTTAAAATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCG
The putative transcription start (+1) of hU6 promoter is 23 nt from the TATA box, and the researchers also investigated and found that all 23 eukaryotic U6 promoters in the NCBI database have a +1 position of G. The +1A/G is much more active than the +1T/C, and when the +1 position is an A/G, the transcription start begins at the +1 position, and when the +1 position is a C or a T, the transcription start partially or completely becomes a -1 position.
The above findings also explain why, when designing sgRNAs, if the first position of the sgRNA is not a G, a G is usually added to promote the transcription of the sgRNA.
The sequence of human H1 promoter:
GGAATTCGAACGCTGACGTCATCAACCCGCTCCAAGGAATCGCGGGCCCAGTGTCACTAGGCGGGAACACCCAGCGCGCGTGCGCCCTGGCAGGAAGATGGCTGTGAGGGACAGGGGAGTGGCGCCCTGCAATATTTGCATGTCGCTATGTGTTCTGGGAAATCACCATAAACGTGAAATGTCTTTGGATTTGGGAATCTTATAAGTTCTGTATGAGACCACTCTTTCCCA
The putative transcriptional start (+1 position) of human H1 promoter is 25 nt apart from the TATATA box, and the researchers investigated and found the distribution of bases at the +1 position of the H1 promoter in the NCBI database for 18 eukaryotes: 5A, 2T, 2C, and 9G. The +1A/G is twice as active as the +1T/C transcriptional activity, but the transcriptional start is not conserved, and most of them lie between -3/-1 window.
Several studies have shown that it appears that the U6 and 7SK promoters are more transcriptionally active than the H1 promoter.
Other type 3 Pol III promoter sequences
Mouse U6 promoter
Gatccgacgccgccatctctaggcccgcgccggccccctcgcacagacttgtgggagaagctcggctactcccctgccccggttaatttgcatataatatttcctagtaactatagaggcttaatgtgcgataaaagacagataatctgttctttttaatactagctacattttacatgataggcttggatttctataagagatacaaatactaaattattattttaaaaaacagcacaaaaggaaactcaccctaactgtaaagtaattgtgtgttttgagactataaatatcccttggagaaaagccttgtt
Chicken H1 promoter
Ggcaccagacccattcacacccccaaccccccaagctgaggctgcccgtggccccatccatggccttggggacctcgacggatggggcacgcgcaactcctgcaccctcccaaccgctccgtataccgccgctccctcactcccagcacgaggcggggcggggccgccgtcattagcatacaccgcagagcatgccgggtaactcgccctactctaaaagggttccggaaccagagctgtatataggcacttccacaaagtgcgt
Pig H1 promoter
Ggtccctctcccgcgcgcagccatggatccctaacatcgacgtcatcaaccacttcctaggaatctgccggcgcagtctcaaggcgggaacatgtattgcgcgtgcgtcctggagcgaagctgcctgcaccggacggggacgaacgcgccacaatatttgcatgtcgcaatgtcttatgggaaatcaccataactatgaaatctctctacttatgggagttttataagtgctcacagaagcagttttcctacgt
Mouse H1 promoter
GAAGGACGACGTCATCATCCCTTGCCCGGATGCGCGGGCTTCTTGTCTAGCACAGGAGCCTGGGGTAGAGCGCATGCAAATTACGCGCTGTGCTTTGTGGGAAATCACCCTAAACGAAAAATTTATTCCTCTTTCGAGCCTTATAGTGGCGGCCGGTCTACAT
References
1. Gao Z, Harwig A, Berkhout B, Herrera-Carrillo E. Mutation of nucleotides around the +1 position of type 3 polymerase III promoters: The effect on transcriptional activity and start site usage. Transcription. 2017;8(5):275-287. doi: 10.1080/21541264.2017.1322170. Epub 2017 Jun 9. PMID: 28598252; PMCID: PMC5703244.
2. Goguen RP, Del Corpo O, Malard CMG, Daher A, Alpuche-Lazcano SP, Chen MJ, Scarborough RJ, Gatignol A. Efficacy, accumulation, and transcriptional profile of anti-HIV shRNAs expressed from human U6, 7SK, and H1 promoters. Mol Ther Nucleic Acids. 2021 Jan 1;23:1020-1034. doi: 10.1016/j.omtn.2020.12.022. PMID: 33614248; PMCID: PMC7868930.
3. Yin HC, Chen XY, Wang W, Meng QW. Identification and comparison of the porcine H1, U6, and 7SK RNA polymerase III promoters for short hairpin RNA expression. Mamm Genome. 2020 Apr;31(3-4):110-116. doi: 10.1007/s00335-020-09838-0. Epub 2020 Apr 21. PMID: 32318815.
Souce: NovoPro 2024-08-02