pG-Tf2 vector (V012822)

Price Information

Cat No. Plasmid Name Availability Add to cart
V012822 pG-Tf2 In stock, 1 week for quality controls

Buy one, get one free!

Two tubes of lyophilized plasmid will be delivered, each tube is about 5µg.

Basic Vector Information

Plasmid pG-Tf2 could express TF and GroEL-GroES together under the tetracycline-inducible promoter (Pzt-1)

Vector Name:
pG-Tf2
Antibiotic Resistance:
Chloramphenicol
Length:
8290 bp
Type:
E.coli expression plasmid
Replication origin:
p15A ori
Source/Author:
Takashi Yura
Copy Number:
Medium copy number
Promoter:
Pzt-1
5' Primer:
GGTAGCTCAGAGAACCTTCG
3' Primer:
gccatctcttcgatcaggc
Growth Strain(s):
DH5alpha
Growth Temperature:
37℃

pG-Tf2 vector Vector Map

pG-Tf28290 bp400800120016002000240028003200360040004400480052005600600064006800720076008000RBSS loopChaperonin GroELTrigger FactorrrnB T1 terminatortetR/tetA promotersTetRCmRcat promoterp15A ori

Plasmid Resuspension Protocol:

1. Centrifuge at 5,000×g for 5 min.

2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.

3. Close the tube and incubate for 10 minutes at room temperature.

4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.

5.Store the plasmid at -20 ℃.

pG-Tf2 vector Sequence

Copy Sequence

Download GeneBank File(.gb)

LOCUS       V012822                 8290 bp    DNA     circular SYN 19-OCT-2023
DEFINITION  Exported.
ACCESSION   V012822
VERSION     V012822
KEYWORDS    .
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
            .
REFERENCE   1  (bases 1 to 8290)
  AUTHORS   .
  TITLE     Direct Submission
FEATURES             Location/Qualifiers
     source          1..8290
                     /mol_type="other DNA"
                     /organism="synthetic DNA construct"
     RBS             98..109
                     /note="strong bacterial ribosome binding site (Elowitz and
                     Leibler, 2000)"
     CDS             206..259
                     /label="S loop"
                     /note="GroES chaperone mobile loop that interacts with
                     GroEL"
     CDS             498..2141
                     /gene="groEL"
                     /label="Chaperonin GroEL"
                     /note="Chaperonin GroEL from Escherichia coli O8 (strain
                     IAI1). Accession#: B7M8Q4"
     CDS             2202..3497
                     /label="Trigger Factor"
                     /note="ribosome-associated chaperone from E. coli (Hoffmann
                     et al., 2010)"
     terminator      4387..4473
                     /label="rrnB T1 terminator"
                     /note="transcription terminator T1 from the E. coli rrnB
                     gene"
     promoter        complement(4533..4588)
                     /label="tetR/tetA promoters"
                     /note="overlapping promoters for bacterial tetR and tetA"
     CDS             4604..5227
                     /label="TetR"
                     /note="tetracycline repressor TetR"
     CDS             complement(6248..6904)
                     /label="CmR"
                     /note="chloramphenicol acetyltransferase"
     promoter        complement(6905..7007)
                     /label="cat promoter"
                     /note="promoter of the E. coli cat gene encoding
                     chloramphenicol acetyltransferase"
     rep_origin      complement(7533..8077)
                     /direction=LEFT
                     /label="p15A ori"
                     /note="Plasmids containing the medium-copy-number p15A
                     origin of replication can be propagated in E. coli cells
                     that contain a second plasmid with the ColE1 origin."