Price Information
Cat No. | Plasmid Name | Availability | Add to cart |
---|---|---|---|
V012745 | pYD1 | In stock, instant shipping |
Buy one, get one free! |
Two tubes of lyophilized plasmid will be delivered, each tube is about 5µg.
Basic Vector Information
pYD1 is a 5.0 kb expression vector designed for expression, secretion, and display of proteins on the extracellular surface of Saccharomyces cerevisiae cells. The vector contains the following elements:1. AGA2 gene from Saccharomyces cerevisiae. This gene encodes one of the subunits of the a-agglutinin receptor. Fusion of the gene of interest to AGA2 allows secretion and display of the protein of interest. 2. GAL1 promoter for regulated expression of the AGA2 gene fusion. 3. Xpress epitope and V5 epitope for detection of the displayed protein. 4. Polyhistidine (6xHis) tag for detection and possible purification on metal chelating resin. 5. TRP1 gene for selection in Saccharomyces cerevisiae. 6. CEN6/ARS4 for stable, episomal replication in yeast. 7. Ampicillin resistance gene and the pUC origin for selection and replication in E. coli.
- Vector Name:
- pYD1
- Antibiotic Resistance:
- Ampicillin
- Length:
- 5009 bp
- Type:
- Yeast Plasmids
- Replication origin:
- ori
- Source/Author:
- Invitrogen
- Selection Marker:
- TRP1
- Copy Number:
- High copy number
- Promoter:
- GAL1
- Cloning Method:
- Enzyme Cut
- 5' Primer:
- pYD1-F: AGTAACGTTTGTCAGTAATTGC
- 3' Primer:
- pYD1-R: GTCGATTTTGTTACATCTACAC
- Growth Strain(s):
- DH10B
- Growth Temperature:
- 37℃
pYD1 vector Vector Map
Plasmid Protocol
1. Centrifuge at 5,000×g for 5 min.
2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.
5. Store the plasmid at -20 ℃.
6. The concentration of plasmid re-measurement sometimes differs from the nominal value, which may be due to the position of the lyophilized plasmid in the tube, the efficiency of the re-dissolution, the measurement bias, and adsorption on the wall of the tube, therefore, it is recommended to transform and extract the plasmid before using it
General Plasmid Transform Protocol
1. Take one 100μl of the competent cells and thaw it on ice for 10min, add 2μl of plasmid, then ice bath for 30min, then heat-shock it at 42℃ for 60s, do not stir, and then ice bath for 2min.
2. Add 900μl of LB liquid medium without antibiotics, and incubate at 37℃ for 45min (30℃ for 1-1.5 hours) with 180rpm shaking.
3. Centrifuge at 6000rpm for 5min, leave only 100μl of supernatant to resuspend the bacterial precipitate and spread it onto the target plasmid-resistant LB plate.
4. Invert the plate and incubate at 37℃ for 14h, or at 30℃ for 20h.
5. Pick a single colony into LB liquid medium, add the corresponding antibiotics, incubate at 220rpm for 14h, and extract the plasmid according to the experimental needs and the instructions of the plasmid extraction kit.
References
- Yang YY, Zheng SY, Fang H, Wu XM, Zhang J, Chang MX. Immunoprotective Effects of Two Histone H2A Variants in the Grass Carp Against Flavobacterium columnare Infection. Front Immunol. 2022 Jul 11;13:939464.
pYD1 vector Sequence
LOCUS V012745 5009 bp DNA circular SYN 11-SEP-2021 DEFINITION Exported. ACCESSION V012745 VERSION V012745 KEYWORDS pYD1 SOURCE synthetic DNA construct ORGANISM synthetic DNA construct . REFERENCE 1 (bases 1 to 5009) TITLE Direct Submission REFERENCE 2 (bases 1 to 5009) AUTHORS . TITLE Direct Submission COMMENT SGRef: number: 1; type: "Journal Article" FEATURES Location/Qualifiers source 1..5009 /mol_type="other DNA" /organism="synthetic DNA construct" promoter 2..443 /label="GAL1 promoter" /note="inducible promoter, regulated by Gal4" promoter 475..493 /label="T7 promoter" /note="promoter for bacteriophage T7 RNA polymerase" CDS 534..794 /gene="AGA2" /label="A-agglutinin-binding subunit" /note="A-agglutinin-binding subunit from Saccharomyces cerevisiae (strain ATCC 204508 / S288c). Accession#: P32781" CDS 858..887 /codon_start=1 /product="leader peptide from bacteriophage T7 gene 10" /label="leader peptide from bacteriophage T7 gene 10" /note="T7 tag (gene 10 leader)" /note="promotes efficient translation in E. coli" /translation="ASMTGGQQMG" CDS 891..914 /label="Xpress(TM) tag" /note="Xpress(TM) epitope tag, including an enterokinase recognition and cleavage site" CDS 993..1034 /label="V5 tag" /note="epitope tag from simian virus 5" CDS 1044..1061 /label="6xHis" /note="6xHis affinity tag" CDS complement(1436..2107) /label="TRP1" /note="phosphoribosylanthranilate isomerase, required for tryptophan biosynthesis" promoter complement(2108..2209) /label="TRP1 promoter" misc_feature complement(2286..2789) /label="CEN/ARS" /note="S. cerevisiae CEN6 centromere fused to an autonomously replicating sequence" promoter 2826..2930 /label="AmpR promoter" CDS 2931..3788 /label="AmpR" /note="beta-lactamase" rep_origin 3962..4550 /label="ori" /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of replication" protein_bind 4838..4859 /label="CAP binding site" /note="CAP binding activates transcription in the presence of cAMP." promoter 4874..4904 /label="lac promoter" /note="promoter for the E. coli lac operon" protein_bind 4912..4928 /label="lac operator" /note="The lac repressor binds to the lac operator to inhibit transcription in E. coli. This inhibition can be relieved by adding lactose or isopropyl-beta-D-thiogalactopyranoside (IPTG)." primer_bind 4936..4952 /label="M13 rev" /note="common sequencing primer, one of multiple similar variants" promoter 4973..4991 /label="T3 promoter" /note="promoter for bacteriophage T3 RNA polymerase"