tet-pLKO-sgRNA-puro vector (Cat. No.: V011750)

tet-pLKO-sgRNA-puro8880 bp40080012001600200024002800320036004000440048005200560060006400680072007600800084008800hPGK promoterbeta-globin intronpCAG-FT7 promoterTetRIRESPuroR3' LTR (Delta-U3)SV40 poly(A) signalSV40 oriT7 promoterM13 fwdf1 oriAmpR promoterAmpRoriL4440CAP binding sitelac promoterlac operatorM13 revT3 promoterRSV promoter5' LTR (truncated)HIV-1 PsiRREgp41 peptideProtein TatH1-2O2 promotercPPT/CTShPGK promoter
Basic Information
Name:
tet-pLKO-sgRNA-puro
Antibiotic Resistance:
Ampicillin
Length:
8880 bp
Type:
Mammalian Expression, Lentiviral, CRISPR
Replication origin:
ori
Selection Marker:
Puromycin
Copy Number:
Low Copy
Promoter:
hPGK
Cloning Method:
Restriction Enzyme
5' Primer:
tet-pLKO-seq-1: 5’- GTTTCAGACCCACCTCCCAAC’-3
$ 198.2
In stock, 1 week for quality controls
Buy one, get one free! (?)
Two tubes of lyophilized plasmid will be delivered, each tube is about 5µg.

Plasmid Protocol

1. Centrifuge at 5,000×g for 5 min.

2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.

3. Close the tube and incubate for 10 minutes at room temperature.

4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.

5. Store the plasmid at -20 ℃.

6. The concentration of plasmid re-measurement sometimes differs from the nominal value, which may be due to the position of the lyophilized plasmid in the tube, the efficiency of the re-dissolution, the measurement bias, and adsorption on the wall of the tube, therefore, it is recommended to transform and extract the plasmid before using it

General Plasmid Transform Protocol

1. Take one 100μl of the competent cells and thaw it on ice for 10min, add 2μl of plasmid, then ice bath for 30min, then heat-shock it at 42℃ for 60s, do not stir, and then ice bath for 2min.

2. Add 900μl of LB liquid medium without antibiotics, and incubate at 37℃ for 45min (30℃ for 1-1.5 hours) with 180rpm shaking.

3. Centrifuge at 6000rpm for 5min, leave only 100μl of supernatant to resuspend the bacterial precipitate and spread it onto the target plasmid-resistant LB plate.

4. Invert the plate and incubate at 37℃ for 14h, or at 30℃ for 20h.

5. Pick a single colony into LB liquid medium, add the corresponding antibiotics, incubate at 220rpm for 14h, and extract the plasmid according to the experimental needs and the instructions of the plasmid extraction kit.

tet-pLKO-sgRNA-puro vector (Cat. No.: V011750) Sequence

LOCUS       V011750                 8880 bp    DNA     circular SYN 13-MAY-2021
DEFINITION  Exported.
ACCESSION   V011750
VERSION     V011750
KEYWORDS    tet-pLKO-sgRNA-puro
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
            .
REFERENCE   1  (bases 1 to 8880)
  AUTHORS   Huang HT, Seo HS, Zhang T, Wang Y, Jiang B, Li Q, Buckley DL, Nabet
            B, Roberts JM, Paulk J, Dastjerdi S, Winter GE, McLauchlan H, Moran
            J, Bradner JE, Eck MJ, Dhe-Paganon S, Zhao JJ, Gray NS
  TITLE     MELK is not necessary for the proliferation of basal-like breast
            cancer cells.
  JOURNAL   Elife. 2017 Sep 19;6. pii: e26693. doi: 10.7554/eLife.26693.
   PUBMED   28926338
REFERENCE   2  (bases 1 to 8880)
  TITLE     Direct Submission
REFERENCE   3  (bases 1 to 8880)
  AUTHORS   .
  TITLE     Direct Submission
COMMENT     SGRef: number: 1; type: "Journal Article"; journalName: "Elife.";
            date: "2017-09-19"; pages: "
            10.7554/eLife.26693"
            SGRef: number: 2; type: "Journal Article"
FEATURES             Location/Qualifiers
     source          1..8880
                     /mol_type="other DNA"
                     /organism="synthetic DNA construct"
     promoter        7..507
                     /label="hPGK promoter"
                     /note="human phosphoglycerate kinase 1 promoter"
     intron          516..1088
                     /label="beta-globin intron"
                     /note="intron from rabbit beta-globin gene"
     primer_bind     1096..1115
                     /label="pCAG-F"
                     /note="Rabbit beta-globin intron, for pCAG plasmids,
                     forward primer"
     promoter        1143..1161
                     /label="T7 promoter"
                     /note="promoter for bacteriophage T7 RNA polymerase"
     CDS             1172..1792
                     /label="TetR"
                     /note="tetracycline repressor TetR"
     misc_feature    1827..2400
                     /label="IRES"
                     /note="internal ribosome entry site (IRES) of the
                     encephalomyocarditis virus (EMCV)"
     CDS             2420..3016
                     /label="PuroR"
                     /note="puromycin N-acetyltransferase"
     LTR             3147..3380
                     /label="3' LTR (Delta-U3)"
                     /note="self-inactivating 3' long terminal repeat (LTR) from
                     HIV-1"
     polyA_signal    3452..3586
                     /label="SV40 poly(A) signal"
                     /note="SV40 polyadenylation signal"
     rep_origin      3613..3748
                     /label="SV40 ori"
                     /note="SV40 origin of replication"
     promoter        complement(3769..3787)
                     /label="T7 promoter"
                     /note="promoter for bacteriophage T7 RNA polymerase"
     primer_bind     complement(3797..3813)
                     /label="M13 fwd"
                     /note="common sequencing primer, one of multiple similar
                     variants"
     rep_origin      3955..4410
                     /label="f1 ori"
                     /note="f1 bacteriophage origin of replication; arrow
                     indicates direction of (+) strand synthesis"
     promoter        4436..4540
                     /label="AmpR promoter"
     CDS             4541..5398
                     /label="AmpR"
                     /note="beta-lactamase"
     rep_origin      5572..6160
                     /label="ori"
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
                     replication"
     primer_bind     6314..6331
                     /label="L4440"
                     /note="L4440 vector, forward primer"
     protein_bind    6448..6469
                     /label="CAP binding site"
                     /note="CAP binding activates transcription in the presence
                     of cAMP."
     promoter        6484..6514
                     /label="lac promoter"
                     /note="promoter for the E. coli lac operon"
     protein_bind    6522..6538
                     /label="lac operator"
                     /note="The lac repressor binds to the lac operator to
                     inhibit transcription in E. coli. This inhibition can be
                     relieved by adding lactose or
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     primer_bind     6546..6562
                     /label="M13 rev"
                     /note="common sequencing primer, one of multiple similar
                     variants"
     promoter        6583..6601
                     /label="T3 promoter"
                     /note="promoter for bacteriophage T3 RNA polymerase"
     promoter        6629..6855
                     /label="RSV promoter"
                     /note="Rous sarcoma virus enhancer/promoter"
     LTR             6856..7036
                     /label="5' LTR (truncated)"
                     /note="truncated 5' long terminal repeat (LTR) from HIV-1"
     misc_feature    7083..7208
                     /label="HIV-1 Psi"
                     /note="packaging signal of human immunodeficiency virus
                     type 1"
     misc_feature    7701..7934
                     /label="RRE"
                     /note="The Rev response element (RRE) of HIV-1 allows for
                     Rev-dependent mRNA export from the nucleus to the
                     cytoplasm."
     CDS             8119..8163
                     /label="gp41 peptide"
                     /note="antigenic peptide corresponding to amino acids 655
                     to 669 of the HIV envelope protein gp41 (Lutje Hulsik et
                     al., 2013)"
     CDS             8312..8353
                     /note="Protein Tat from Human immunodeficiency virus type 1
                     group M subtype B (isolate WMJ22). Accession#: P12509"
                     /label="Protein Tat"
     promoter        8452..8546
                     /label="H1-2O2 promoter"
                     /note="doxycycline-inducible variant of the human H1 RNA
                     promoter (Henriksen et al., 2007)"
     misc_feature    8711..8828
                     /label="cPPT/CTS"
                     /note="central polypurine tract and central termination
                     sequence of HIV-1"
     promoter        8877..8880
                     /label="hPGK promoter"
                     /note="human phosphoglycerate kinase 1 promoter"