Price Information
Cat No. | Plasmid Name | Availability | Add to cart |
---|---|---|---|
V004043 | pTet-PLKO-puro | In stock, 1 week for quality controls |
Buy one, get one free! |
Two tubes of lyophilized plasmid will be delivered, each tube is about 5µg.
Basic Vector Information
3rd generation lentiviral plasmid for inducible expression of shRNA; puromycin selection
- Vector Name:
- pTet-PLKO-puro
- Antibiotic Resistance:
- Ampicillin
- Length:
- 10633 bp
- Type:
- Lentiviral vectors
- Replication origin:
- ori
- Selection Marker:
- Puromycin
- Copy Number:
- Low copy number
- Promoter:
- hPGK
- 5' Primer:
- GGCAGGGATATTCACCATTATCGTTTCAGA
pTet-PLKO-puro vector Map
Plasmid Protocol
1. Centrifuge at 5,000×g for 5 min.
2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.
5. Store the plasmid at -20 ℃.
6. The concentration of plasmid re-measurement sometimes differs from the nominal value, which may be due to the position of the lyophilized plasmid in the tube, the efficiency of the re-dissolution, the measurement bias, and adsorption on the wall of the tube, therefore, it is recommended to transform and extract the plasmid before using it
General Plasmid Transform Protocol
1. Take one 100μl of the competent cells and thaw it on ice for 10min, add 2μl of plasmid, then ice bath for 30min, then heat-shock it at 42℃ for 60s, do not stir, and then ice bath for 2min.
2. Add 900μl of LB liquid medium without antibiotics, and incubate at 37℃ for 45min (30℃ for 1-1.5 hours) with 180rpm shaking.
3. Centrifuge at 6000rpm for 5min, leave only 100μl of supernatant to resuspend the bacterial precipitate and spread it onto the target plasmid-resistant LB plate.
4. Invert the plate and incubate at 37℃ for 14h, or at 30℃ for 20h.
5. Pick a single colony into LB liquid medium, add the corresponding antibiotics, incubate at 220rpm for 14h, and extract the plasmid according to the experimental needs and the instructions of the plasmid extraction kit.
pTet-PLKO-puro vector Sequence
LOCUS V004043 10633 bp DNA circular SYN 13-JAN-2022 DEFINITION Exported. ACCESSION V004043 VERSION V004043 KEYWORDS . SOURCE synthetic DNA construct ORGANISM synthetic DNA construct . REFERENCE 1 (bases 1 to 10633) TITLE Direct Submission REFERENCE 2 (bases 1 to 10633) AUTHORS . TITLE Direct Submission COMMENT SGRef: number: 1; type: "Journal Article" FEATURES Location/Qualifiers source 1..10633 /mol_type="other DNA" /organism="synthetic DNA construct" promoter 7..507 /label="hPGK promoter" /note="human phosphoglycerate kinase 1 promoter" intron 516..1088 /label="beta-globin intron" /note="intron from rabbit beta-globin gene" promoter 1143..1161 /label="T7 promoter" /note="promoter for bacteriophage T7 RNA polymerase" CDS 1172..1792 /label="TetR" /note="tetracycline repressor TetR" misc_feature 1827..2400 /label="IRES" /note="internal ribosome entry site (IRES) of the encephalomyocarditis virus (EMCV)" CDS 2420..3016 /label="PuroR" /note="puromycin N-acetyltransferase" LTR 3147..3380 /label="3' LTR (Delta-U3)" /note="self-inactivating 3' long terminal repeat (LTR) from HIV-1" polyA_signal 3452..3586 /label="SV40 poly(A) signal" /note="SV40 polyadenylation signal" rep_origin 3613..3748 /label="SV40 ori" /note="SV40 origin of replication" promoter complement(3769..3787) /label="T7 promoter" /note="promoter for bacteriophage T7 RNA polymerase" primer_bind complement(3797..3813) /label="M13 fwd" /note="M13 fwd" /note="common sequencing primer, one of multiple similar variants" rep_origin 3955..4410 /label="f1 ori" /note="f1 bacteriophage origin of replication; arrow indicates direction of (+) strand synthesis" promoter 4436..4540 /label="AmpR promoter" CDS 4541..5398 /label="AmpR" /note="beta-lactamase" rep_origin 5572..6160 /label="ori" /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of replication" protein_bind 6448..6469 /label="CAP binding site" /note="CAP binding activates transcription in the presence of cAMP." promoter 6484..6514 /label="lac promoter" /note="promoter for the E. coli lac operon" protein_bind 6522..6538 /label="lac repressor encoded by lacI binding site" /bound_moiety="lac repressor encoded by lacI" /note="lac operator" /note="The lac repressor binds to the lac operator to inhibit transcription in E. coli. This inhibition can be relieved by adding lactose or isopropyl-beta-D-thiogalactopyranoside (IPTG)." primer_bind 6546..6562 /label="M13 rev" /note="M13 rev" /note="common sequencing primer, one of multiple similar variants" promoter 6583..6601 /label="T3 promoter" /note="promoter for bacteriophage T3 RNA polymerase" promoter 6629..6855 /label="RSV promoter" /note="Rous sarcoma virus enhancer/promoter" LTR 6856..7036 /label="5' LTR (truncated)" /note="5' LTR (truncated)" /note="truncated 5' long terminal repeat (LTR) from HIV-1" misc_feature 7083..7208 /label="HIV-1 Psi" /note="packaging signal of human immunodeficiency virus type 1" misc_feature 7701..7934 /label="RRE" /note="The Rev response element (RRE) of HIV-1 allows for Rev-dependent mRNA export from the nucleus to the cytoplasm." CDS 8119..8163 /label="gp41 peptide" /note="antigenic peptide corresponding to amino acids 655 to 669 of the HIV envelope protein gp41 (Lutje Hulsik et al., 2013)" CDS 8312..8353 /note="Protein Tat from Human immunodeficiency virus type 1 group M subtype B (isolate WMJ22). Accession#: P12509" /label="Protein Tat" promoter 8452..8546 /label="H1-2O2 promoter" /note="doxycycline-inducible variant of the human H1 RNA promoter (Henriksen et al., 2007)" promoter 10000..10507 /label="hPGK promoter" /note="human phosphoglycerate kinase 1 promoter"