Price Information
Cat No. | Plasmid Name | Availability | Add to cart |
---|---|---|---|
V004047 | pPRIME-TREX-GFP-FF3 | In stock, 1 week for quality controls |
Buy one, get one free! |
Two tubes of lyophilized plasmid will be delivered, each tube is about 5µg.
Basic Vector Information
Lentiviral expression vector for shRNA expression with inducible (TREX) promter, fluorescent (GFP) marker; amp and chloramphenicol restsance; restriction enzyme cloning.
- Vector Name:
- pPRIME-TREX-GFP-FF3
- Antibiotic Resistance:
- Chloramphenicol
- Length:
- 8600 bp
- Type:
- Lentiviral vectors
- Replication origin:
- ori
- Copy Number:
- Low copy number
- Promoter:
- TREX
- Cloning Method:
- Enzyme digestion and ligation
- 5' Primer:
- EGFP-C Foward: CATGGTCCTGCTGGAGTTCGTG
- Fusion Tag:
- GFP
pPRIME-TREX-GFP-FF3 vector Vector Map
Plasmid Protocol
1. Centrifuge at 5,000×g for 5 min.
2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.
5. Store the plasmid at -20 ℃.
6. The concentration of plasmid re-measurement sometimes differs from the nominal value, which may be due to the position of the lyophilized plasmid in the tube, the efficiency of the re-dissolution, the measurement bias, and adsorption on the wall of the tube, therefore, it is recommended to transform and extract the plasmid before using it
General Plasmid Transform Protocol
1. Take one 100μl of the competent cells and thaw it on ice for 10min, add 2μl of plasmid, then ice bath for 30min, then heat-shock it at 42℃ for 60s, do not stir, and then ice bath for 2min.
2. Add 900μl of LB liquid medium without antibiotics, and incubate at 37℃ for 45min (30℃ for 1-1.5 hours) with 180rpm shaking.
3. Centrifuge at 6000rpm for 5min, leave only 100μl of supernatant to resuspend the bacterial precipitate and spread it onto the target plasmid-resistant LB plate.
4. Invert the plate and incubate at 37℃ for 14h, or at 30℃ for 20h.
5. Pick a single colony into LB liquid medium, add the corresponding antibiotics, incubate at 220rpm for 14h, and extract the plasmid according to the experimental needs and the instructions of the plasmid extraction kit.
pPRIME-TREX-GFP-FF3 vector Sequence
LOCUS V004047 8600 bp DNA circular SYN 13-JAN-2022 DEFINITION Exported. ACCESSION V004047 VERSION V004047 KEYWORDS . SOURCE synthetic DNA construct ORGANISM synthetic DNA construct . REFERENCE 1 (bases 1 to 8600) TITLE Direct Submission REFERENCE 2 (bases 1 to 8600) AUTHORS . TITLE Direct Submission COMMENT SGRef: number: 1; type: "Journal Article" FEATURES Location/Qualifiers source 1..8600 /mol_type="other DNA" /organism="synthetic DNA construct" enhancer 238..617 /label="CMV enhancer" /note="human cytomegalovirus immediate early enhancer" misc_feature 1023..1148 /label="HIV-1 Psi" /note="packaging signal of human immunodeficiency virus type 1" misc_feature 1645..1878 /label="RRE" /note="The Rev response element (RRE) of HIV-1 allows for Rev-dependent mRNA export from the nucleus to the cytoplasm." CDS 2063..2107 /label="gp41 peptide" /note="antigenic peptide corresponding to amino acids 655 to 669 of the HIV envelope protein gp41 (Lutje Hulsik et al., 2013)" CDS 2256..2297 /note="Protein Tat from Human immunodeficiency virus type 1 group M subtype B (isolate WMJ22). Accession#: P12509" /label="Protein Tat" misc_feature 2405..2522 /label="cPPT/CTS" /note="central polypurine tract and central termination sequence of HIV-1" enhancer 2681..2984 /label="CMV enhancer" /note="human cytomegalovirus immediate early enhancer" promoter 2985..3188 /label="CMV promoter" /note="human cytomegalovirus (CMV) immediate early promoter" protein_bind 3190..3208 /label="tet operator" /note="bacterial operator O2 for the tetR and tetA genes" protein_bind 3211..3229 /gene="tetO" /label="tetracycline repressor TetR binding site" /bound_moiety="tetracycline repressor TetR" /note="tet operator" /note="bacterial operator O2 for the tetR and tetA genes" CDS 3302..4018 /label="EGFP" /note="enhanced GFP" ncRNA 4071..4164 /label="5' miR-30a" /note="sequence upstream of the 71-nt precursor of the human miR-30a microRNA (Zeng et al., 2002)" ncRNA 4178..4290 /label="3' miR-30a" /note="sequence downstream of the 71-nt precursor of the human miR-30a microRNA (Zeng et al., 2002)" promoter 4443..4545 /label="cat promoter" /note="promoter of the E. coli cat gene encoding chloramphenicol acetyltransferase" CDS 4546..5202 /label="CmR" /note="chloramphenicol acetyltransferase" CDS 5337..5366 /label="Myc" /note="Myc (human c-Myc proto-oncogene) epitope tag" misc_feature 5489..6077 /label="WPRE" /note="woodchuck hepatitis virus posttranscriptional regulatory element" primer_bind complement(6080..6096) /label="KS primer" /note="common sequencing primer, one of multiple similar variants" LTR 6606..6786 /label="5' LTR (truncated)" /note="truncated 5' long terminal repeat (LTR) from HIV-1" rep_origin complement(6848..7436) /direction=LEFT /label="ori" /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of replication" CDS complement(7610..8467) /label="AmpR" /note="beta-lactamase" promoter complement(8468..8572) /label="AmpR promoter"