Price Information
| Cat No. | Plasmid Name | Availability | Add to cart |
|---|---|---|---|
| V006548 | pRNATin-H1.2/Retro | In stock, 1 week for quality controls |
Buy one, get one free! |
Two tubes of lyophilized plasmid will be delivered, each tube is about 5µg.
Basic Vector Information
pRNATin-H1.2/Retro siRNA expression vector is compatible with Clontech Retro-X Expression System. It uses an inducible H1 promoter for siRNA expression. The promoter contains the tetracycline operator (TetO1). As a competitor, tetracycline or doxycycline can bind this operator to remove the blockade of tetracycline repressor (TetR) from H1 promoter and induce the transcription of siRNA.The vector also carries a neomycin resistance gene for establishing stable transfection cell line and a cGFP marker for tracking transfection efficiency, both genes are under the control of SV40 promoter. The vector uses CMV enhancer/promoter joined MSV 5’LTR (CMV/MSV 5'LTR) and MSV 3'LTR for viral transcription and packaging.
- Vector Name:
- pRNATin-H1.2/Retro
- Antibiotic Resistance:
- Ampicillin
- Length:
- 7706 bp
- Type:
- RNAi vectors
- Replication origin:
- ori
- Selection Marker:
- Neomycin
- Promoter:
- H1.2
- Cloning Method:
- Enzyme digestion and ligation
- 5' Primer:
- CCAACTTGTTTATTGCAGCT
- 3' Primer:
- TAATACGACTCACTATAGGG
- Fusion Tag:
- cGFP
pRNATin-H1.2/Retro vector Vector Map
Plasmid Protocol
1. Centrifuge at 5,000×g for 5 min.
2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.
5. Store the plasmid at -20 ℃.
6. The concentration of plasmid re-measurement sometimes differs from the nominal value, which may be due to the position of the lyophilized plasmid in the tube, the efficiency of the re-dissolution, the measurement bias, and adsorption on the wall of the tube, therefore, it is recommended to transform and extract the plasmid before using it
General Plasmid Transform Protocol
1. Take one 100μl of the competent cells and thaw it on ice for 10min, add 2μl of plasmid, then ice bath for 30min, then heat-shock it at 42℃ for 60s, do not stir, and then ice bath for 2min.
2. Add 900μl of LB liquid medium without antibiotics, and incubate at 37℃ for 45min (30℃ for 1-1.5 hours) with 180rpm shaking.
3. Centrifuge at 6000rpm for 5min, leave only 100μl of supernatant to resuspend the bacterial precipitate and spread it onto the target plasmid-resistant LB plate.
4. Invert the plate and incubate at 37℃ for 14h, or at 30℃ for 20h.
5. Pick a single colony into LB liquid medium, add the corresponding antibiotics, incubate at 220rpm for 14h, and extract the plasmid according to the experimental needs and the instructions of the plasmid extraction kit.
pRNATin-H1.2/Retro vector Sequence
LOCUS 40924_37498 7706 bp DNA circular SYN 13-JAN-2022
DEFINITION synthetic circular DNA.
ACCESSION .
VERSION .
KEYWORDS .
SOURCE synthetic DNA construct
ORGANISM synthetic DNA construct
REFERENCE 1 (bases 1 to 7706)
TITLE Direct Submission
REFERENCE 2 (bases 1 to 7706)
AUTHORS .
TITLE Direct Submission
COMMENT SGRef: number: 1; type: "Journal Article"
FEATURES Location/Qualifiers
source 1..7706
/mol_type="other DNA"
/organism="synthetic DNA construct"
enhancer 5..308
/label=CMV enhancer
/note="human cytomegalovirus immediate early enhancer"
promoter 309..512
/label=CMV promoter
/note="human cytomegalovirus (CMV) immediate early
promoter"
LTR 513..688
/label=5' LTR (truncated)
/note="truncated long terminal repeat from Moloney murine
sarcoma virus"
misc_feature 751..950
/label=MMLV Psi
/note="packaging signal of Moloney murine leukemia virus
(MMLV)"
CDS 1151..1567
/label=gag (truncated)
/note="truncated Moloney murine leukemia virus (MMLV) gag
gene lacking the start codon"
promoter 1604..1920
/note="SV40 promoter"
/note="SV40 enhancer and early promoter"
rep_origin 1771..1906
/label=SV40 ori
/note="SV40 ori"
/note="SV40 origin of replication"
CDS 1932..2648
/label=AcGFP1
/note="Aequorea coerulescens GFP"
misc_feature 2665..3238
/label=IRES
/note="internal ribosome entry site (IRES) of the
encephalomyocarditis virus (EMCV)"
CDS 3270..4061
/label=NeoR/KanR
/note="aminoglycoside phosphotransferase"
polyA_signal 4238..4359
/label=SV40 poly(A) signal
/note="SV40 polyadenylation signal"
protein_bind complement(4421..4439)
/label=tet operator
/note="bacterial operator O1 for the tetR and tetA genes"
promoter complement(4515..4533)
/label=T7 promoter
/note="promoter for bacteriophage T7 RNA polymerase"
promoter 5103..5432
/label=SV40 promoter
/note="SV40 enhancer and early promoter"
rep_origin complement(5725..6313)
/direction=LEFT
/label=ori
/note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
replication"
CDS complement(6487..7344)
/label=AmpR
/note="beta-lactamase"
promoter complement(7345..7449)
/label=AmpR promoter
enhancer 7635..7706
/label=CMV enhancer
/note="human cytomegalovirus immediate early enhancer"