Price Information
| Cat No. | Plasmid Name | Availability | Add to cart |
|---|---|---|---|
| V007253 | pU6-pegRNA-GG-acceptor | In stock, 1 week for quality controls |
Buy one, get one free! |
Two tubes of lyophilized plasmid will be delivered, each tube is about 5µg.
Basic Vector Information
- Vector Name:
- pU6-pegRNA-GG-acceptor
- Antibiotic Resistance:
- Ampicillin
- Length:
- 3004 bp
- Type:
- Mammalian Expression
- Replication origin:
- ori
- Copy Number:
- High Copy
- Promoter:
- U6
- Cloning Method:
- Ligation Independent Cloning
- 5' Primer:
- GACTATCATATGCTTACCGT
pU6-pegRNA-GG-acceptor vector Map
Plasmid Protocol
1. Centrifuge at 5,000×g for 5 min.
2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.
5. Store the plasmid at -20 ℃.
6. The concentration of plasmid re-measurement sometimes differs from the nominal value, which may be due to the position of the lyophilized plasmid in the tube, the efficiency of the re-dissolution, the measurement bias, and adsorption on the wall of the tube, therefore, it is recommended to transform and extract the plasmid before using it
General Plasmid Transform Protocol
1. Take one 100μl of the competent cells and thaw it on ice for 10min, add 2μl of plasmid, then ice bath for 30min, then heat-shock it at 42℃ for 60s, do not stir, and then ice bath for 2min.
2. Add 900μl of LB liquid medium without antibiotics, and incubate at 37℃ for 45min (30℃ for 1-1.5 hours) with 180rpm shaking.
3. Centrifuge at 6000rpm for 5min, leave only 100μl of supernatant to resuspend the bacterial precipitate and spread it onto the target plasmid-resistant LB plate.
4. Invert the plate and incubate at 37℃ for 14h, or at 30℃ for 20h.
5. Pick a single colony into LB liquid medium, add the corresponding antibiotics, incubate at 220rpm for 14h, and extract the plasmid according to the experimental needs and the instructions of the plasmid extraction kit.
pU6-pegRNA-GG-acceptor vector Sequence
LOCUS pU6-pegRNA-GG-ac 3004 bp DNA circular SYN 13-MAY-2021
DEFINITION Prime editing in mammalian cells.
ACCESSION .
VERSION .
KEYWORDS pU6-pegRNA-GG-acceptor
SOURCE synthetic DNA construct
ORGANISM synthetic DNA construct
REFERENCE 1 (bases 1 to 3004)
AUTHORS Anzalone AV, Randolph PB, Davis JR, Sousa AA, Koblan LW, Levy JM,
Chen PJ, Wilson C, Newby GA, Raguram A, Liu DR
TITLE Search-and-replace genome editing without double-strand breaks or
donor DNA.
JOURNAL Nature. 2019 Oct 21. pii: 10.1038/s41586-019-1711-4. doi:
10.1038/s41586-019-1711-4.
PUBMED 31634902
REFERENCE 2 (bases 1 to 3004)
TITLE Direct Submission
REFERENCE 3 (bases 1 to 3004)
AUTHORS .
TITLE Direct Submission
COMMENT SGRef: number: 1; type: "Journal Article"; journalName: "Nature.
2019 Oct 21. pii: 10.1038/s41586-019-1711-4. doi:
10.1038/s41586-019-1711-4."
COMMENT SGRef: number: 2; type: "Journal Article"
FEATURES Location/Qualifiers
source 1..3004
/mol_type="other DNA"
/organism="synthetic DNA construct"
promoter 1..241
/label=U6 promoter
/note="RNA polymerase III promoter for human U6 snRNA"
terminator complement(259..290)
/label=tonB terminator
/note="bidirectional E. coli tonB-P14 transcription
terminator"
CDS complement(310..984)
/label=mRFP1
/note="monomeric derivative of DsRed (Campbell et al.,
2002)"
RBS 991..1002
/note="strong bacterial ribosome binding site (Elowitz and
Leibler, 2000)"
protein_bind 1020..1038
/gene="tetO"
/label=tet operator
/bound_moiety="tetracycline repressor TetR"
/note="bacterial operator O2 for the tetR and tetA genes"
protein_bind complement(1045..1063)
/label=tet operator
/note="bacterial operator O2 for the tetR and tetA genes"
rep_origin complement(1174..1762)
/direction=LEFT
/label=ori
/note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
replication"
CDS complement(1936..2793)
/label=AmpR
/note="beta-lactamase"
promoter complement(2794..2898)
/label=AmpR promoter