Price Information
Cat No. | Plasmid Name | Availability | Add to cart |
---|---|---|---|
V007266 | pJMP2 | In stock, 1 week for quality controls |
Buy one, get one free! |
Two tubes of lyophilized plasmid will be delivered, each tube is about 5µg.
Basic Vector Information
- Vector Name:
- pJMP2
- Antibiotic Resistance:
- Ampicillin
- Length:
- 7572 bp
- Type:
- Bacterial Expression, CRISPR
- Replication origin:
- ori
- Selection Marker:
- Bacillus subtilis chloramphenicol marker
- Copy Number:
- High Copy
- Promoter:
- veg
- Cloning Method:
- Restriction Enzyme
- 5' Primer:
- agtgattatgccgcgatttc
pJMP2 vector Vector Map
Plasmid Protocol
1. Centrifuge at 5,000×g for 5 min.
2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.
5. Store the plasmid at -20 ℃.
6. The concentration of plasmid re-measurement sometimes differs from the nominal value, which may be due to the position of the lyophilized plasmid in the tube, the efficiency of the re-dissolution, the measurement bias, and adsorption on the wall of the tube, therefore, it is recommended to transform and extract the plasmid before using it
General Plasmid Transform Protocol
1. Take one 100μl of the competent cells and thaw it on ice for 10min, add 2μl of plasmid, then ice bath for 30min, then heat-shock it at 42℃ for 60s, do not stir, and then ice bath for 2min.
2. Add 900μl of LB liquid medium without antibiotics, and incubate at 37℃ for 45min (30℃ for 1-1.5 hours) with 180rpm shaking.
3. Centrifuge at 6000rpm for 5min, leave only 100μl of supernatant to resuspend the bacterial precipitate and spread it onto the target plasmid-resistant LB plate.
4. Invert the plate and incubate at 37℃ for 14h, or at 30℃ for 20h.
5. Pick a single colony into LB liquid medium, add the corresponding antibiotics, incubate at 220rpm for 14h, and extract the plasmid according to the experimental needs and the instructions of the plasmid extraction kit.
pJMP2 vector Sequence
LOCUS V007266 7572 bp DNA circular SYN 13-MAY-2021 DEFINITION Exported. ACCESSION V007266 VERSION V007266 KEYWORDS pJMP2 SOURCE synthetic DNA construct ORGANISM synthetic DNA construct . REFERENCE 1 (bases 1 to 7572) AUTHORS Peters JM, Colavin A, Shi H, Czarny TL, Larson MH, Wong S, Hawkins JS, Lu CH, Koo BM, Marta E, Shiver AL, Whitehead EH, Weissman JS, Brown ED, Qi LS, Huang KC, Gross CA TITLE A Comprehensive, CRISPR-based Functional Analysis of Essential Genes in Bacteria. JOURNAL Cell. 2016 Jun 2;165(6):1493-506. doi: 10.1016/j.cell.2016.05.003. Epub 2016 May 26. PUBMED 27238023 REFERENCE 2 (bases 1 to 7572) TITLE Direct Submission REFERENCE 3 (bases 1 to 7572) AUTHORS . TITLE Direct Submission COMMENT SGRef: number: 1; type: "Journal Article"; doi: "10.1016/j.cell.2016.05.003"; journalName: "Cell"; date: "2016-06-2- 2"; volume: "165"; issue: "6"; pages: "1493-506" SGRef: number: 2; type: "Journal Article" FEATURES Location/Qualifiers source 1..7572 /mol_type="other DNA" /organism="synthetic DNA construct" misc_RNA 745..820 /label="gRNA scaffold" /note="guide RNA scaffold for the Streptococcus pyogenes CRISPR/Cas9 system" CDS 841..870 /label="Myc" /note="Myc (human c-Myc proto-oncogene) epitope tag" CDS 886..903 /label="6xHis" /note="6xHis affinity tag" primer_bind complement(959..976) /label="pBAD Reverse" /note="For vectors with E. coli araBAD promoter, reverse primer" terminator 1129..1175 /label="rrnB T1 terminator" /note="transcription terminator T1 from the E. coli rrnB gene" CDS 1556..2203 /gene="cat" /label="Chloramphenicol acetyltransferase" /note="Chloramphenicol acetyltransferase from Staphylococcus aureus. Accession#: P00485" primer_bind complement(2363..2382) /label="pBRrevBam" /note="pBR322 vectors, tet region, downstream of BamHI, reverse primer" CDS 4714..5493 /gene="ant1" /label="Spectinomycin 9-adenylyltransferase" /note="Spectinomycin 9-adenylyltransferase from Staphylococcus aureus (strain N315). Accession#: P0A0D1" rep_origin complement(5743..6331) /direction=LEFT /label="ori" /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of replication" CDS complement(6505..7362) /label="AmpR" /note="beta-lactamase" promoter complement(7363..7467) /label="AmpR promoter" primer_bind 7535..7553 /label="pBRforEco" /note="pBR322 vectors, upsteam of EcoRI site, forward primer"