Price Information
Cat No. | Plasmid Name | Availability | Add to cart |
---|---|---|---|
V007313 | p11-LacY-wtx1 | In stock, 1 week for quality controls |
Buy one, get one free! |
Two tubes of lyophilized plasmid will be delivered, each tube is about 5µg.
Basic Vector Information
- Vector Name:
- p11-LacY-wtx1
- Antibiotic Resistance:
- Ampicillin
- Length:
- 6092 bp
- Replication origin:
- ori
- Selection Marker:
- Ampicillin
- Promoter:
- araBAD
- Cloning Method:
- Restriction Enzyme
- 5' Primer:
- gagctc aggcct gactcactatagggagaccg
- 3' Primer:
- ctagct aggccttaagcgacttcattcacct
p11-LacY-wtx1 vector Map
Plasmid Protocol
1. Centrifuge at 5,000×g for 5 min.
2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.
5. Store the plasmid at -20 ℃.
6. The concentration of plasmid re-measurement sometimes differs from the nominal value, which may be due to the position of the lyophilized plasmid in the tube, the efficiency of the re-dissolution, the measurement bias, and adsorption on the wall of the tube, therefore, it is recommended to transform and extract the plasmid before using it
General Plasmid Transform Protocol
1. Take one 100μl of the competent cells and thaw it on ice for 10min, add 2μl of plasmid, then ice bath for 30min, then heat-shock it at 42℃ for 60s, do not stir, and then ice bath for 2min.
2. Add 900μl of LB liquid medium without antibiotics, and incubate at 37℃ for 45min (30℃ for 1-1.5 hours) with 180rpm shaking.
3. Centrifuge at 6000rpm for 5min, leave only 100μl of supernatant to resuspend the bacterial precipitate and spread it onto the target plasmid-resistant LB plate.
4. Invert the plate and incubate at 37℃ for 14h, or at 30℃ for 20h.
5. Pick a single colony into LB liquid medium, add the corresponding antibiotics, incubate at 220rpm for 14h, and extract the plasmid according to the experimental needs and the instructions of the plasmid extraction kit.
p11-LacY-wtx1 vector Sequence
LOCUS V007313 6092 bp DNA circular SYN 13-MAY-2021 DEFINITION Exported. ACCESSION V007313 VERSION V007313 KEYWORDS p11-LacY-wtx1 SOURCE synthetic DNA construct ORGANISM synthetic DNA construct . REFERENCE 1 (bases 1 to 6092) AUTHORS Chen Z, Zhao H TITLE A highly sensitive selection method for directed evolution of homing endonucleases. JOURNAL Nucleic Acids Res. 2005 Oct 6;33(18):e154. PUBMED 16214805 REFERENCE 2 (bases 1 to 6092) TITLE Direct Submission REFERENCE 3 (bases 1 to 6092) AUTHORS . TITLE Direct Submission COMMENT SGRef: number: 1; type: "Journal Article"; journalName: "Nucleic Acids Res."; date: "2005-10-6"; volume: "33(18)"; pages: "e154" SGRef: number: 2; type: "Journal Article" FEATURES Location/Qualifiers source 1..6092 /mol_type="other DNA" /organism="synthetic DNA construct" CDS complement(98..973) /label="araC" /note="L-arabinose regulatory protein" promoter 1000..1284 /label="araBAD promoter" /note="promoter of the L-arabinose operon of E. coli; the araC regulatory gene is transcribed in the opposite direction (Guzman et al., 1995)" CDS 1316..1618 /label="ccdB" /note="CcdB, a bacterial toxin that poisons DNA gyrase" primer_bind complement(1716..1733) /label="pBAD Reverse" /note="For vectors with E. coli araBAD promoter, reverse primer" terminator 1886..1972 /label="rrnB T1 terminator" /note="transcription terminator T1 from the E. coli rrnB gene" terminator 2064..2091 /label="rrnB T2 terminator" /note="transcription terminator T2 from the E. coli rrnB gene" promoter 2110..2201 /label="AmpR promoter" CDS 2202..3059 /label="AmpR" /note="beta-lactamase" rep_origin 3104..3559 /label="f1 ori" /note="f1 bacteriophage origin of replication; arrow indicates direction of (+) strand synthesis" rep_origin 3670..4258 /label="ori" /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of replication" primer_bind 4412..4429 /label="L4440" /note="L4440 vector, forward primer" protein_bind 4594..4615 /label="CAP binding site" /note="CAP binding activates transcription in the presence of cAMP." promoter 4630..4660 /label="lac promoter" /note="promoter for the E. coli lac operon" protein_bind 4668..4684 /label="lac operator" /note="The lac repressor binds to the lac operator to inhibit transcription in E. coli. This inhibition can be relieved by adding lactose or isopropyl-beta-D-thiogalactopyranoside (IPTG)." primer_bind 4692..4708 /label="M13 rev" /note="common sequencing primer, one of multiple similar variants" primer_bind complement(4724..4740) /label="M13 fwd" /note="common sequencing primer, one of multiple similar variants" CDS 4834..6084 /gene="lacY" /label="Lactose permease" /note="Lactose permease from Escherichia coli (strain K12). Accession#: P02920"