Price Information
| Cat No. | Plasmid Name | Availability | Add to cart |
|---|---|---|---|
| V007360 | LeGO-EBFP2 | In stock, 1 week for quality controls |
Buy one, get one free! |
Two tubes of lyophilized plasmid will be delivered, each tube is about 5µg.
Basic Vector Information
- Vector Name:
- LeGO-EBFP2
- Antibiotic Resistance:
- Ampicillin
- Length:
- 7135 bp
- Type:
- Mammalian Expression, Lentiviral, Cre/Lox
- Replication origin:
- ori
- Copy Number:
- High Copy
- Promoter:
- SFFV
- Cloning Method:
- Restriction Enzyme
- 5' Primer:
- GAGCTCACAACCCCTCACTC
LeGO-EBFP2 vector Map
Plasmid Protocol
1. Centrifuge at 5,000×g for 5 min.
2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.
5. Store the plasmid at -20 ℃.
6. The concentration of plasmid re-measurement sometimes differs from the nominal value, which may be due to the position of the lyophilized plasmid in the tube, the efficiency of the re-dissolution, the measurement bias, and adsorption on the wall of the tube, therefore, it is recommended to transform and extract the plasmid before using it
General Plasmid Transform Protocol
1. Take one 100μl of the competent cells and thaw it on ice for 10min, add 2μl of plasmid, then ice bath for 30min, then heat-shock it at 42℃ for 60s, do not stir, and then ice bath for 2min.
2. Add 900μl of LB liquid medium without antibiotics, and incubate at 37℃ for 45min (30℃ for 1-1.5 hours) with 180rpm shaking.
3. Centrifuge at 6000rpm for 5min, leave only 100μl of supernatant to resuspend the bacterial precipitate and spread it onto the target plasmid-resistant LB plate.
4. Invert the plate and incubate at 37℃ for 14h, or at 30℃ for 20h.
5. Pick a single colony into LB liquid medium, add the corresponding antibiotics, incubate at 220rpm for 14h, and extract the plasmid according to the experimental needs and the instructions of the plasmid extraction kit.
LeGO-EBFP2 vector Sequence
LOCUS V007360 7135 bp DNA circular SYN 13-MAY-2021
DEFINITION Exported.
ACCESSION V007360
VERSION V007360
KEYWORDS LeGO-EBFP2
SOURCE synthetic DNA construct
ORGANISM synthetic DNA construct
.
REFERENCE 1 (bases 1 to 7135)
AUTHORS Mohme M, Maire CL, Riecken K, Zapf S, Aranyossy T, Westphal M,
Lamszus K, Fehse B
TITLE Optical Barcoding for Single-Clone Tracking to Study Tumor
Heterogeneity.
JOURNAL Mol Ther. 2017 Jan 18. pii: S1525-0016(16)45496-1. doi:
10.1016/j.ymthe.2016.12.014.
PUBMED 28109958
REFERENCE 2 (bases 1 to 7135)
TITLE Direct Submission
REFERENCE 3 (bases 1 to 7135)
AUTHORS .
TITLE Direct Submission
COMMENT SGRef: number: 1; type: "Journal Article"; journalName: "Mol Ther.
2017 Jan 18. pii: S1525-0016(16)45496-1. doi:
10.1016/j.ymthe.2016.12.014."
SGRef: number: 2; type: "Journal Article"
FEATURES Location/Qualifiers
source 1..7135
/mol_type="other DNA"
/organism="synthetic DNA construct"
primer_bind complement(47..66)
/label="pRS-marker"
/note="pRS vectors, use to sequence yeast selectable
marker"
enhancer 238..617
/label="CMV enhancer"
/note="human cytomegalovirus immediate early enhancer"
promoter 618..820
/label="CMV promoter"
/note="human cytomegalovirus (CMV) immediate early
promoter"
LTR 835..1015
/label="5' LTR (truncated)"
/note="truncated 5' long terminal repeat (LTR) from HIV-1"
misc_feature 1062..1187
/label="HIV-1 Psi"
/note="packaging signal of human immunodeficiency virus
type 1"
misc_feature 1684..1917
/label="RRE"
/note="The Rev response element (RRE) of HIV-1 allows for
Rev-dependent mRNA export from the nucleus to the
cytoplasm."
CDS 2102..2146
/label="gp41 peptide"
/note="antigenic peptide corresponding to amino acids 655
to 669 of the HIV envelope protein gp41 (Lutje Hulsik et
al., 2013)"
CDS 2295..2336
/note="Protein Tat from Human immunodeficiency virus type 1
group M subtype B (isolate WMJ22). Accession#: P12509"
/label="Protein Tat"
misc_feature 2444..2561
/label="cPPT/CTS"
/note="central polypurine tract and central termination
sequence of HIV-1"
primer_bind 2620..2636
/label="KS primer"
/note="common sequencing primer, one of multiple similar
variants"
protein_bind 2678..2711
/label="loxP"
/bound_moiety="Cre recombinase"
/note="Cre-mediated recombination occurs in the 8-bp core
sequence (GCATACAT)."
promoter 2778..3184
/label="SFFV promoter"
/note="spleen focus-forming virus long terminal repeat
(LTR) promoter"
CDS 3196..3912
/label="EBFP2"
/note="enhanced blue variant of GFP (Ai et al., 2007)"
protein_bind complement(3935..3968)
/label="loxP"
/note="Cre-mediated recombination occurs in the 8-bp core
sequence (ATGTATGC) (Shaw et al., 2021)."
misc_feature 4024..4612
/label="WPRE"
/note="woodchuck hepatitis virus posttranscriptional
regulatory element"
primer_bind complement(4615..4631)
/label="KS primer"
/note="common sequencing primer, one of multiple similar
variants"
LTR 5141..5321
/label="5' LTR (truncated)"
/note="truncated 5' long terminal repeat (LTR) from HIV-1"
rep_origin complement(5383..5971)
/direction=LEFT
/label="ori"
/note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
replication"
CDS complement(6145..7002)
/label="AmpR"
/note="beta-lactamase"
promoter complement(7003..7107)
/label="AmpR promoter"