Basic Vector Information
- Vector Name:
- CGBE1 (pRZ3885)
- Antibiotic Resistance:
- Ampicillin
- Length:
- 9909 bp
- Type:
- Mammalian Expression
- Replication origin:
- ori
- Copy Number:
- High Copy
- Promoter:
- CMV
- Cloning Method:
- Gibson Cloning
- 5' Primer:
- CGCAAATGGGCGGTAGGCGTG
- 3' Primer:
- TAGAAGGCACAGTCGAGG
CGBE1 (pRZ3885) vector Vector Map
Plasmid Resuspension Protocol:
1. Centrifuge at 5,000×g for 5 min.
2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.
5.Store the plasmid at -20 ℃.
CGBE1 (pRZ3885) vector Sequence
LOCUS CGBE1_(pRZ3885). 9909 bp DNA circular SYN 13-MAY-2021 DEFINITION CMV promoter expression plasmid for UNG(E.coli)-rAPOBEC1(R33A)-nCas9-P2A-EGFP. ACCESSION . VERSION . KEYWORDS CGBE1 (pRZ3885). SOURCE synthetic DNA construct ORGANISM synthetic DNA construct REFERENCE 1 (bases 1 to 9909) AUTHORS Kurt IC, Zhou R, Iyer S, Garcia SP, Miller BR, Langner LM, Grunewald J, Joung JK TITLE CRISPR C-to-G base editors for inducing targeted DNA transversions in human cells. JOURNAL Nat Biotechnol. 2020 Jul 20. pii: 10.1038/s41587-020-0609-x. doi: 10.1038/s41587-020-0609-x. PUBMED 32690971 REFERENCE 2 (bases 1 to 9909) TITLE Direct Submission REFERENCE 3 (bases 1 to 9909) AUTHORS . TITLE Direct Submission COMMENT SGRef: number: 1; type: "Journal Article"; journalName: "Nat Biotechnol. 2020 Jul 20. pii: 10.1038/s41587-020-0609-x. doi: 10.1038/s41587-020-0609-x." COMMENT SGRef: number: 2; type: "Journal Article" FEATURES Location/Qualifiers source 1..9909 /mol_type="other DNA" /organism="synthetic DNA construct" primer_bind 220..239 /label=pBR322ori-F /note="pBR322 origin, forward primer" primer_bind 473..490 /label=L4440 /note="L4440 vector, forward primer" protein_bind 607..628 /label=CAP binding site /note="CAP binding activates transcription in the presence of cAMP." promoter 643..673 /label=lac promoter /note="promoter for the E. coli lac operon" protein_bind 681..697 /label=lac operator /note="The lac repressor binds to the lac operator to inhibit transcription in E. coli. This inhibition can be relieved by adding lactose or isopropyl-beta-D-thiogalactopyranoside (IPTG)." primer_bind 705..721 /label=M13 rev /note="common sequencing primer, one of multiple similar variants" polyA_signal complement(792..1016) /label=bGH poly(A) signal /note="bovine growth hormone polyadenylation signal" CDS complement(1045..1062) /label=6xHis /note="6xHis affinity tag" CDS complement(1071..1787) /label=EGFP /note="enhanced GFP" CDS complement(1788..1844) /codon_start=1 /product="2A peptide from porcine teschovirus-1 polyprotein" /label=P2A /note="Eukaryotic ribosomes fail to insert a peptide bond between the Gly and Pro residues, yielding separate polypeptides." /translation="ATNFSLLKQAGDVEENPGP" CDS complement(1863..1883) /label=SV40 NLS /note="nuclear localization signal of SV40 (simian virus 40) large T antigen" CDS complement(1926..6026) /label=Cas9(D10A) /note="nickase mutant of the Cas9 endonuclease from the Streptococcus pyogenes Type II CRISPR/Cas system" CDS complement(6123..6806) /label=APOBEC-1 /note="cytidine deaminase (C to U editing enzyme) from rat" CDS complement(6837..7523) /gene="ung" /label=ung /note="Uracil-DNA glycosylase from Escherichia coli (strain K12). Accession#: P12295" CDS complement(7521..7541) /label=SV40 NLS /note="nuclear localization signal of SV40 (simian virus 40) large T antigen" promoter complement(7591..7609) /label=T7 promoter /note="promoter for bacteriophage T7 RNA polymerase" promoter complement(7651..7854) /label=CMV promoter /note="human cytomegalovirus (CMV) immediate early promoter" enhancer complement(7855..8234) /label=CMV enhancer /note="human cytomegalovirus immediate early enhancer" primer_bind 8406..8425 /label=pRS-marker /note="pRS vectors, use to sequence yeast selectable marker" promoter 8504..8608 /label=AmpR promoter CDS 8609..9466 /label=AmpR /note="beta-lactamase" rep_origin 9640..9909 /label=ori /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of replication"
This page is informational only.