CGBE1 (pRZ3885) vector (V007416)

Price Information

Cat No. Plasmid Name Availability Add to cart
V007416 CGBE1 (pRZ3885) In stock, 1 week for quality controls

Buy one, get one free!

Two tubes of lyophilized plasmid will be delivered, each tube is about 5µg.

Basic Vector Information

Vector Name:
CGBE1 (pRZ3885)
Antibiotic Resistance:
Ampicillin
Length:
9909 bp
Type:
Mammalian Expression
Replication origin:
ori
Copy Number:
High Copy
Promoter:
CMV
Cloning Method:
Gibson Cloning
5' Primer:
CGCAAATGGGCGGTAGGCGTG
3' Primer:
TAGAAGGCACAGTCGAGG

CGBE1 (pRZ3885) vector Map

CGBE1 (pRZ3885)9909 bp4008001200160020002400280032003600400044004800520056006000640068007200760080008400880092009600pBR322ori-FL4440CAP binding sitelac promoterlac operatorM13 revbGH poly(A) signal6xHisEGFPP2ASV40 NLSCas9(D10A)APOBEC-1Uracil-DNA glycosylaseT7 promoterCMV promoterCMV enhancerpRS-markerAmpR promoterAmpRori

Plasmid Protocol

1. Centrifuge at 5,000×g for 5 min.

2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.

3. Close the tube and incubate for 10 minutes at room temperature.

4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.

5. Store the plasmid at -20 ℃.

6. The concentration of plasmid re-measurement sometimes differs from the nominal value, which may be due to the position of the lyophilized plasmid in the tube, the efficiency of the re-dissolution, the measurement bias, and adsorption on the wall of the tube, therefore, it is recommended to transform and extract the plasmid before using it

General Plasmid Transform Protocol

1. Take one 100μl of the competent cells and thaw it on ice for 10min, add 2μl of plasmid, then ice bath for 30min, then heat-shock it at 42℃ for 60s, do not stir, and then ice bath for 2min.

2. Add 900μl of LB liquid medium without antibiotics, and incubate at 37℃ for 45min (30℃ for 1-1.5 hours) with 180rpm shaking.

3. Centrifuge at 6000rpm for 5min, leave only 100μl of supernatant to resuspend the bacterial precipitate and spread it onto the target plasmid-resistant LB plate.

4. Invert the plate and incubate at 37℃ for 14h, or at 30℃ for 20h.

5. Pick a single colony into LB liquid medium, add the corresponding antibiotics, incubate at 220rpm for 14h, and extract the plasmid according to the experimental needs and the instructions of the plasmid extraction kit.

CGBE1 (pRZ3885) vector Sequence

LOCUS       V007416                 9909 bp    DNA     circular SYN 13-MAY-2021
DEFINITION  Exported.
ACCESSION   V007416
VERSION     V007416
KEYWORDS    CGBE1 (pRZ3885)
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
            .
REFERENCE   1  (bases 1 to 9909)
  AUTHORS   Kurt IC, Zhou R, Iyer S, Garcia SP, Miller BR, Langner LM, Grunewald
            J, Joung JK
  TITLE     CRISPR C-to-G base editors for inducing targeted DNA transversions
            in human cells.
  JOURNAL   Nat Biotechnol. 2020 Jul 20. pii: 10.1038/s41587-020-0609-x. doi:
            10.1038/s41587-020-0609-x.
   PUBMED   32690971
REFERENCE   2  (bases 1 to 9909)
  TITLE     Direct Submission
REFERENCE   3  (bases 1 to 9909)
  AUTHORS   .
  TITLE     Direct Submission
COMMENT     SGRef: number: 1; type: "Journal Article"; journalName: "Nat
            Biotechnol. 2020 Jul 20. pii: 10.1038/s41587-020-0609-x. doi:
            10.1038/s41587-020-0609-x."
            SGRef: number: 2; type: "Journal Article"
FEATURES             Location/Qualifiers
     source          1..9909
                     /mol_type="other DNA"
                     /organism="synthetic DNA construct"
     primer_bind     220..239
                     /label="pBR322ori-F"
                     /note="pBR322 origin, forward primer"
     primer_bind     473..490
                     /label="L4440"
                     /note="L4440 vector, forward primer"
     protein_bind    607..628
                     /label="CAP binding site"
                     /note="CAP binding activates transcription in the presence
                     of cAMP."
     promoter        643..673
                     /label="lac promoter"
                     /note="promoter for the E. coli lac operon"
     protein_bind    681..697
                     /label="lac operator"
                     /note="The lac repressor binds to the lac operator to
                     inhibit transcription in E. coli. This inhibition can be
                     relieved by adding lactose or
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     primer_bind     705..721
                     /label="M13 rev"
                     /note="common sequencing primer, one of multiple similar
                     variants"
     polyA_signal    complement(792..1016)
                     /label="bGH poly(A) signal"
                     /note="bovine growth hormone polyadenylation signal"
     CDS             complement(1045..1062)
                     /label="6xHis"
                     /note="6xHis affinity tag"
     CDS             complement(1071..1787)
                     /label="EGFP"
                     /note="enhanced GFP"
     CDS             complement(1788..1844)
                     /codon_start=1
                     /product="2A peptide from porcine teschovirus-1
                     polyprotein"
                     /label="P2A"
                     /note="Eukaryotic ribosomes fail to insert a peptide bond
                     between the Gly and Pro residues, yielding separate
                     polypeptides."
                     /translation="ATNFSLLKQAGDVEENPGP"
     CDS             complement(1863..1883)
                     /label="SV40 NLS"
                     /note="nuclear localization signal of SV40 (simian virus
                     40) large T antigen"
     CDS             complement(1926..6026)
                     /label="Cas9(D10A)"
                     /note="nickase mutant of the Cas9 endonuclease from the
                     Streptococcus pyogenes Type II CRISPR/Cas system"
     CDS             complement(6123..6806)
                     /label="APOBEC-1"
                     /note="cytidine deaminase (C to U editing enzyme) from rat"
     CDS             complement(6837..7523)
                     /gene="ung"
                     /label="Uracil-DNA glycosylase"
                     /note="Uracil-DNA glycosylase from Escherichia coli (strain
                     K12). Accession#: P12295"
     CDS             complement(7521..7541)
                     /label="SV40 NLS"
                     /note="nuclear localization signal of SV40 (simian virus
                     40) large T antigen"
     promoter        complement(7591..7609)
                     /label="T7 promoter"
                     /note="promoter for bacteriophage T7 RNA polymerase"
     promoter        complement(7651..7854)
                     /label="CMV promoter"
                     /note="human cytomegalovirus (CMV) immediate early
                     promoter"
     enhancer        complement(7855..8234)
                     /label="CMV enhancer"
                     /note="human cytomegalovirus immediate early enhancer"
     primer_bind     8406..8425
                     /label="pRS-marker"
                     /note="pRS vectors, use to sequence yeast selectable
                     marker"
     promoter        8504..8608
                     /label="AmpR promoter"
     CDS             8609..9466
                     /label="AmpR"
                     /note="beta-lactamase"
     rep_origin      9640..9909
                     /label="ori"
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
                     replication"