pY108 (lenti-AsCpf1) vector (V000051)

Price Information

Cat No. Plasmid Name Availability Buy one, get one free! (?)
V000051 pY108 (lenti-AsCpf1) In stock, 1 week for quality controls

Two tubes of lyophilized plasmid will be delivered, each tube is about 5µg.

Basic Vector Information

Vector Name:
pY108 (lenti-AsCpf1)
Antibiotic Resistance:
Ampicillin
Length:
12863 bp
Type:
Lentiviral
Replication origin:
ori
Selection Marker:
Puromycin
Promoter:
SV40
Cloning Method:
Gibson Cloning
5' Primer:
aggtcttgaaaggagtgggaattgg

pY108 (lenti-AsCpf1) vector Map

pY108 (lenti-AsCpf1)12863 bp6001200180024003000360042004800540060006600720078008400900096001020010800114001200012600CMV enhancerCMV promoter5' LTR (truncated)HIV-1 PsiRREgp41 peptideProtein TatcPPT/CTSU6 promoterEF-1-alpha core promoterKozak sequenceSV40 NLSAsCpf1nucleoplasmin NLS3xHAP2APuroRWPRE3' LTR (Delta-U3)bGH poly(A) signalf1 oriSV40 promoterEM7 promoterBleoRSV40 poly(A) signalM13/pUC Reverselac promoterCAP binding siteL4440oriAmpRAmpR promoterpRS-marker

Plasmid Protocol

1. Centrifuge at 5,000×g for 5 min.

2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.

3. Close the tube and incubate for 10 minutes at room temperature.

4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.

5. Store the plasmid at -20 ℃.

6. The concentration of plasmid re-measurement sometimes differs from the nominal value, which may be due to the position of the lyophilized plasmid in the tube, the efficiency of the re-dissolution, the measurement bias, and adsorption on the wall of the tube, therefore, it is recommended to transform and extract the plasmid before using it

General Plasmid Transform Protocol

1. Take one 100μl of the competent cells and thaw it on ice for 10min, add 2μl of plasmid, then ice bath for 30min, then heat-shock it at 42℃ for 60s, do not stir, and then ice bath for 2min.

2. Add 900μl of LB liquid medium without antibiotics, and incubate at 37℃ for 45min (30℃ for 1-1.5 hours) with 180rpm shaking.

3. Centrifuge at 6000rpm for 5min, leave only 100μl of supernatant to resuspend the bacterial precipitate and spread it onto the target plasmid-resistant LB plate.

4. Invert the plate and incubate at 37℃ for 14h, or at 30℃ for 20h.

5. Pick a single colony into LB liquid medium, add the corresponding antibiotics, incubate at 220rpm for 14h, and extract the plasmid according to the experimental needs and the instructions of the plasmid extraction kit.

pY108 (lenti-AsCpf1) vector Sequence

LOCUS       V000051                12863 bp    DNA     circular SYN 13-MAY-2021
DEFINITION  Exported.
ACCESSION   V000051
VERSION     V000051
KEYWORDS    pY108 (lenti-AsCpf1)
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
            .
REFERENCE   1  (bases 1 to 12863)
  AUTHORS   Zetsche B, Heidenreich M, Mohanraju P, Fedorova I, Kneppers J,
            DeGennaro EM, Winblad N, Choudhury SR, Abudayyeh OO, Gootenberg JS,
            Wu WY, Scott DA, Severinov K, van der Oost J, Zhang F
  TITLE     Multiplex gene editing by CRISPR-Cpf1 using a single crRNA array.
  JOURNAL   Nat Biotechnol. 2017 Jan;35(1):31-34. doi: 10.1038/nbt.3737. Epub
            2016 Dec 5.
   PUBMED   27918548
REFERENCE   2  (bases 1 to 12863)
  TITLE     Direct Submission
REFERENCE   3  (bases 1 to 12863)
  AUTHORS   .
  TITLE     Direct Submission
COMMENT     SGRef: number: 1; type: "Journal Article"; doi: "10.1038/nbt.3737";
            journalName: "Nat Biotechnol"; date: "2017-01"; volume: "35"; issue:
            "1"; pages: "31-34"
            SGRef: number: 2; type: "Journal Article"
FEATURES             Location/Qualifiers
     source          1..12863
                     /mol_type="other DNA"
                     /organism="synthetic DNA construct"
     enhancer        1..380
                     /label="CMV enhancer"
                     /note="human cytomegalovirus immediate early enhancer"
     promoter        381..583
                     /label="CMV promoter"
                     /note="human cytomegalovirus (CMV) immediate early
                     promoter"
     LTR             598..778
                     /label="5' LTR (truncated)"
                     /note="truncated 5' long terminal repeat (LTR) from HIV-1"
     misc_feature    825..950
                     /label="HIV-1 Psi"
                     /note="packaging signal of human immunodeficiency virus
                     type 1"
     misc_feature    1443..1676
                     /label="RRE"
                     /note="The Rev response element (RRE) of HIV-1 allows for
                     Rev-dependent mRNA export from the nucleus to the
                     cytoplasm."
     CDS             1861..1905
                     /label="gp41 peptide"
                     /note="antigenic peptide corresponding to amino acids 655
                     to 669 of the HIV envelope protein gp41 (Lutje Hulsik et
                     al., 2013)"
     CDS             2054..2095
                     /note="Protein Tat from Human immunodeficiency virus type 1
                     group M subtype B (isolate WMJ22). Accession#: P12509"
                     /label="Protein Tat"
     misc_feature    2203..2320
                     /label="cPPT/CTS"
                     /note="central polypurine tract and central termination
                     sequence of HIV-1"
     promoter        complement(2422..2662)
                     /label="U6 promoter"
                     /note="RNA polymerase III promoter for human U6 snRNA"
     promoter        2711..2922
                     /label="EF-1-alpha core promoter"
                     /note="core promoter for human elongation factor
                     EF-1-alpha"
     regulatory      2930..2939
                     /label="Kozak sequence"
                     /note="vertebrate consensus sequence for strong initiation
                     of translation (Kozak, 1987)"
                     /regulatory_class="other"
     CDS             2942..2962
                     /codon_start=1
                     /product="nuclear localization signal of SV40 (simian virus
                     40) large T antigen"
                     /label="SV40 NLS"
                     /translation="PKKKRKV"
     CDS             2987..6904
                     /label="AsCpf1"
                     /note="CRISPR-associated protein from Acidaminococcus sp.
                     BV3L6 (Zetsche et al., 2015)"
     CDS             6905..6952
                     /codon_start=1
                     /product="bipartite nuclear localization signal from
                     nucleoplasmin"
                     /label="nucleoplasmin NLS"
                     /translation="KRPAATKKAGQAKKKK"
     CDS             6959..7039
                     /codon_start=1
                     /product="three tandem HA epitope tags"
                     /label="3xHA"
                     /translation="YPYDVPDYAYPYDVPDYAYPYDVPDYA"
     CDS             7049..7105
                     /label="P2A"
                     /note="2A peptide from porcine teschovirus-1 polyprotein"
     CDS             7106..7699
                     /label="PuroR"
                     /note="puromycin N-acetyltransferase"
     misc_feature    7718..8306
                     /label="WPRE"
                     /note="woodchuck hepatitis virus posttranscriptional
                     regulatory element"
     LTR             8378..8611
                     /label="3' LTR (Delta-U3)"
                     /note="self-inactivating 3' long terminal repeat (LTR) from
                     HIV-1"
     polyA_signal    8643..8867
                     /label="bGH poly(A) signal"
                     /note="bovine growth hormone polyadenylation signal"
     rep_origin      8913..9341
                     /label="f1 ori"
                     /note="f1 bacteriophage origin of replication; arrow
                     indicates direction of (+) strand synthesis"
     promoter        9355..9684
                     /label="SV40 promoter"
                     /note="SV40 enhancer and early promoter"
     promoter        9732..9779
                     /label="EM7 promoter"
                     /note="synthetic bacterial promoter"
     CDS             9798..10169
                     /label="BleoR"
                     /note="antibiotic-binding protein"
     polyA_signal    10302..10435
                     /label="SV40 poly(A) signal"
                     /note="SV40 polyadenylation signal"
     primer_bind     complement(10472..10488)
                     /label="M13 rev"
                     /note="common sequencing primer, one of multiple similar
                     variants"
     primer_bind     complement(10472..10488)
                     /label="M13 Reverse"
                     /note="In lacZ gene. Also called M13-rev"
     primer_bind     complement(10485..10507)
                     /label="M13/pUC Reverse"
                     /note="In lacZ gene"
     protein_bind    10496..10512
                     /label="lac operator"
                     /bound_moiety="lac repressor encoded by lacI"
                     /note="The lac repressor binds to the lac operator to
                     inhibit transcription in E. coli. This inhibition can be
                     relieved by adding lactose or
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     promoter        complement(10520..10550)
                     /label="lac promoter"
                     /note="promoter for the E. coli lac operon"
     protein_bind    complement(10565..10586)
                     /label="CAP binding site"
                     /note="CAP binding activates transcription in the presence
                     of cAMP."
     primer_bind     complement(10703..10720)
                     /label="L4440"
                     /note="L4440 vector, forward primer"
     rep_origin      complement(10874..11462)
                     /direction=LEFT
                     /label="ori"
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
                     replication"
     CDS             complement(11636..12493)
                     /label="AmpR"
                     /note="beta-lactamase"
     promoter        complement(12494..12598)
                     /label="AmpR promoter"
     primer_bind     complement(12673..12692)
                     /label="pRS-marker"
                     /note="pRS vectors, use to sequence yeast selectable
                     marker"