Price Information
| Cat No. | Plasmid Name | Availability | Add to cart |
|---|---|---|---|
| V006649 | FUW-tetO-hOKMS | In stock, 1 week for quality controls |
Buy one, get one free! |
Two tubes of lyophilized plasmid will be delivered, each tube is about 5µg.
Basic Vector Information
- Vector Name:
- FUW-tetO-hOKMS
- Antibiotic Resistance:
- Ampicillin
- Length:
- 13356 bp
- Type:
- Mammalian Expression, Lentiviral
- Replication origin:
- ori
- Copy Number:
- High Copy
- Promoter:
- EM7
- Cloning Method:
- Restriction Enzyme
- 5' Primer:
- agagctcgtttagtgaaccg
- 3' Primer:
- gttgcgtcagcaaacacagt
FUW-tetO-hOKMS vector Map
Plasmid Protocol
1. Centrifuge at 5,000×g for 5 min.
2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.
5. Store the plasmid at -20 ℃.
6. The concentration of plasmid re-measurement sometimes differs from the nominal value, which may be due to the position of the lyophilized plasmid in the tube, the efficiency of the re-dissolution, the measurement bias, and adsorption on the wall of the tube, therefore, it is recommended to transform and extract the plasmid before using it
General Plasmid Transform Protocol
1. Take one 100μl of the competent cells and thaw it on ice for 10min, add 2μl of plasmid, then ice bath for 30min, then heat-shock it at 42℃ for 60s, do not stir, and then ice bath for 2min.
2. Add 900μl of LB liquid medium without antibiotics, and incubate at 37℃ for 45min (30℃ for 1-1.5 hours) with 180rpm shaking.
3. Centrifuge at 6000rpm for 5min, leave only 100μl of supernatant to resuspend the bacterial precipitate and spread it onto the target plasmid-resistant LB plate.
4. Invert the plate and incubate at 37℃ for 14h, or at 30℃ for 20h.
5. Pick a single colony into LB liquid medium, add the corresponding antibiotics, incubate at 220rpm for 14h, and extract the plasmid according to the experimental needs and the instructions of the plasmid extraction kit.
FUW-tetO-hOKMS vector Sequence
LOCUS V006649 13356 bp DNA circular SYN 13-MAY-2021
DEFINITION Exported.
ACCESSION V006649
VERSION V006649
KEYWORDS FUW-tetO-hOKMS
SOURCE synthetic DNA construct
ORGANISM synthetic DNA construct
.
REFERENCE 1 (bases 1 to 13356)
AUTHORS Cacchiarelli D, Trapnell C, Ziller MJ, Soumillon M, Cesana M, Karnik
R, Donaghey J, Smith ZD, Ratanasirintrawoot S, Zhang X, Ho Sui SJ,
Wu Z, Akopian V, Gifford CA, Doench J, Rinn JL, Daley GQ, Meissner
A, Lander ES, Mikkelsen TS
TITLE Integrative Analyses of Human Reprogramming Reveal Dynamic Nature of
Induced Pluripotency.
JOURNAL Cell. 2015 Jul 16;162(2):412-24. doi: 10.1016/j.cell.2015.06.016.
PUBMED 26186193
REFERENCE 2 (bases 1 to 13356)
TITLE Direct Submission
REFERENCE 3 (bases 1 to 13356)
AUTHORS .
TITLE Direct Submission
COMMENT SGRef: number: 1; type: "Journal Article"; doi:
"10.1016/j.cell.2015.06"; journalName: "Cell"; date: "2015-07-16-
16"; volume: "162"; issue: "2"; pages: "412-24"
SGRef: number: 2; type: "Journal Article"
FEATURES Location/Qualifiers
source 1..13356
/mol_type="other DNA"
/organism="synthetic DNA construct"
enhancer 7..386
/label="CMV enhancer"
/note="human cytomegalovirus immediate early enhancer"
promoter 387..589
/label="CMV promoter"
/note="human cytomegalovirus (CMV) immediate early
promoter"
LTR 604..784
/label="5' LTR (truncated)"
/note="truncated 5' long terminal repeat (LTR) from HIV-1"
misc_feature 831..956
/label="HIV-1 Psi"
/note="packaging signal of human immunodeficiency virus
type 1"
misc_feature 1449..1682
/label="RRE"
/note="The Rev response element (RRE) of HIV-1 allows for
Rev-dependent mRNA export from the nucleus to the
cytoplasm."
CDS 1867..1911
/label="gp41 peptide"
/note="antigenic peptide corresponding to amino acids 655
to 669 of the HIV envelope protein gp41 (Lutje Hulsik et
al., 2013)"
CDS 2060..2101
/note="Protein Tat from Human immunodeficiency virus type 1
group M subtype B (isolate WMJ22). Accession#: P12509"
/label="Protein Tat"
misc_feature 2209..2326
/label="cPPT/CTS"
/note="central polypurine tract and central termination
sequence of HIV-1"
protein_bind 2383..2401
/label="tet operator"
/note="bacterial operator O2 for the tetR and tetA genes"
protein_bind 2425..2443
/gene="tetO"
/label="tet operator"
/bound_moiety="tetracycline repressor TetR"
/note="bacterial operator O2 for the tetR and tetA genes"
protein_bind 2467..2485
/gene="tetO"
/label="tet operator"
/bound_moiety="tetracycline repressor TetR"
/note="bacterial operator O2 for the tetR and tetA genes"
protein_bind 2509..2527
/gene="tetO"
/label="tet operator"
/bound_moiety="tetracycline repressor TetR"
/note="bacterial operator O2 for the tetR and tetA genes"
protein_bind 2551..2569
/gene="tetO"
/label="tet operator"
/bound_moiety="tetracycline repressor TetR"
/note="bacterial operator O2 for the tetR and tetA genes"
protein_bind 2593..2611
/gene="tetO"
/label="tet operator"
/bound_moiety="tetracycline repressor TetR"
/note="bacterial operator O2 for the tetR and tetA genes"
promoter 2644..2682
/label="minimal CMV promoter"
/note="human cytomegalovirus (CMV) immediate early
promoter"
primer_bind 2679..2703
/label="LNCX"
/note="Human CMV promoter, forward primer"
CDS 2826..3905
/label="hOct4"
/note="Homo sapiens Oct-4 gene. Encodes a transcription
factor containing a POU homeodomain that plays a key role
in embryonic development and stem cell pluripotency.
Aberrant expression in adult tissues is associated with
tumorigenesis."
CDS 3915..3968
/codon_start=1
/product="2A peptide from Thosea asigna virus capsid
protein"
/label="T2A"
/note="Eukaryotic ribosomes fail to insert a peptide bond
between the Gly and Pro residues, yielding separate
polypeptides."
/translation="EGRGSLLTCGDVEENPGP"
CDS 3969..5378
/label="hKLF4"
/note="Homo sapiens Kruppel-like factor 4 (Klf4) gene.
Belongs to the relatively large family of SP1-like
transcription factors and is involved in the regulation of
proliferation, differentiation, apoptosis and somatic cell
reprogramming."
CDS 5388..5444
/codon_start=1
/product="2A peptide from porcine teschovirus-1
polyprotein"
/label="P2A"
/note="Eukaryotic ribosomes fail to insert a peptide bond
between the Gly and Pro residues, yielding separate
polypeptides."
/translation="ATNFSLLKQAGDVEENPGP"
CDS 5445..6761
/label="c-Myc"
/note="human c-Myc proto-oncogene"
CDS 6771..6830
/codon_start=1
/product="2A peptide from equine rhinitis A virus
polyprotein"
/label="E2A"
/note="Eukaryotic ribosomes fail to insert a peptide bond
between the Gly and Pro residues, yielding separate
polypeptides."
/translation="QCTNYALLKLAGDVESNPGP"
CDS 6831..7781
/label="hSOX2"
/note="Homo sapiens transcription factor SOX-2 gene.
Belongs to the SRY-related HMG-box (SOX) family of
transcription factors, which is involved in the regulation
of embryonic development and in the determination of cell
fate"
misc_feature 7817..8405
/label="WPRE"
/note="woodchuck hepatitis virus posttranscriptional
regulatory element"
primer_bind complement(8408..8424)
/label="KS primer"
/note="common sequencing primer, one of multiple similar
variants"
primer_bind complement(8409..8425)
/label="pBluescriptKS"
/note="For pBluescript vector"
LTR 8930..9110
/label="5' LTR (truncated)"
/note="truncated 5' long terminal repeat (LTR) from HIV-1"
polyA_signal 9142..9366
/label="bGH poly(A) signal"
/note="bovine growth hormone polyadenylation signal"
rep_origin 9412..9840
/label="f1 ori"
/note="f1 bacteriophage origin of replication; arrow
indicates direction of (+) strand synthesis"
primer_bind complement(9849..9869)
/label="pBABE 3'"
/note="SV40 enhancer, reverse primer for pBABE vectors"
rep_origin 10034..10169
/label="SV40 ori"
/note="SV40 origin of replication"
promoter 10231..10278
/label="EM7 promoter"
/note="synthetic bacterial promoter"
CDS 10297..10668
/label="BleoR"
/note="antibiotic-binding protein"
polyA_signal 10801..10934
/label="SV40 poly(A) signal"
/note="SV40 polyadenylation signal"
primer_bind complement(10971..10987)
/label="M13 rev"
/note="common sequencing primer, one of multiple similar
variants"
primer_bind complement(10971..10987)
/label="M13 Reverse"
/note="In lacZ gene. Also called M13-rev"
primer_bind complement(10984..11006)
/label="M13/pUC Reverse"
/note="In lacZ gene"
protein_bind 10995..11011
/label="lac operator"
/bound_moiety="lac repressor encoded by lacI"
/note="The lac repressor binds to the lac operator to
inhibit transcription in E. coli. This inhibition can be
relieved by adding lactose or
isopropyl-beta-D-thiogalactopyranoside (IPTG)."
promoter complement(11019..11049)
/label="lac promoter"
/note="promoter for the E. coli lac operon"
protein_bind complement(11064..11085)
/label="CAP binding site"
/note="CAP binding activates transcription in the presence
of cAMP."
primer_bind complement(11202..11219)
/label="L4440"
/note="L4440 vector, forward primer"
rep_origin complement(11373..11961)
/direction=LEFT
/label="ori"
/note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
replication"
CDS complement(12135..12992)
/label="AmpR"
/note="beta-lactamase"
promoter complement(12993..13097)
/label="AmpR promoter"
primer_bind complement(13172..13191)
/label="pRS-marker"
/note="pRS vectors, use to sequence yeast selectable
marker"