Price Information
| Cat No. | Plasmid Name | Availability | Add to cart |
|---|---|---|---|
| V006687 | Lenti-(BB)-EF1a-KRAB-dCas9-P2A-EGFP | In stock, 1 week for quality controls |
Buy one, get one free! |
Two tubes of lyophilized plasmid will be delivered, each tube is about 5µg.
Basic Vector Information
- Vector Name:
- Lenti-(BB)-EF1a-KRAB-dCas9-P2A-EGFP
- Antibiotic Resistance:
- Ampicillin
- Length:
- 15284 bp
- Type:
- Mammalian Expression, Lentiviral, CRISPR
- Replication origin:
- ori
- Copy Number:
- High Copy
- Promoter:
- U6
- Cloning Method:
- Gibson Cloning
- 5' Primer:
- TAAGAAGTACGGCGGCTTCG
Lenti-(BB)-EF1a-KRAB-dCas9-P2A-EGFP vector Map
Plasmid Protocol
1. Centrifuge at 5,000×g for 5 min.
2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.
5. Store the plasmid at -20 ℃.
6. The concentration of plasmid re-measurement sometimes differs from the nominal value, which may be due to the position of the lyophilized plasmid in the tube, the efficiency of the re-dissolution, the measurement bias, and adsorption on the wall of the tube, therefore, it is recommended to transform and extract the plasmid before using it
General Plasmid Transform Protocol
1. Take one 100μl of the competent cells and thaw it on ice for 10min, add 2μl of plasmid, then ice bath for 30min, then heat-shock it at 42℃ for 60s, do not stir, and then ice bath for 2min.
2. Add 900μl of LB liquid medium without antibiotics, and incubate at 37℃ for 45min (30℃ for 1-1.5 hours) with 180rpm shaking.
3. Centrifuge at 6000rpm for 5min, leave only 100μl of supernatant to resuspend the bacterial precipitate and spread it onto the target plasmid-resistant LB plate.
4. Invert the plate and incubate at 37℃ for 14h, or at 30℃ for 20h.
5. Pick a single colony into LB liquid medium, add the corresponding antibiotics, incubate at 220rpm for 14h, and extract the plasmid according to the experimental needs and the instructions of the plasmid extraction kit.
Lenti-(BB)-EF1a-KRAB-dCas9-P2A-EGFP vector Sequence
LOCUS V006687 15284 bp DNA circular SYN 13-MAY-2021
DEFINITION Exported.
ACCESSION V006687
VERSION V006687
KEYWORDS Lenti-(BB)-EF1a-KRAB-dCas9-P2A-EGFP
SOURCE synthetic DNA construct
ORGANISM synthetic DNA construct
.
REFERENCE 1 (bases 1 to 15284)
TITLE Ferrer Lab Plasmids
REFERENCE 2 (bases 1 to 15284)
TITLE Direct Submission
REFERENCE 3 (bases 1 to 15284)
AUTHORS .
TITLE Direct Submission
COMMENT SGRef: number: 1; type: "Journal Article"
SGRef: number: 2; type: "Journal Article"
FEATURES Location/Qualifiers
source 1..15284
/mol_type="other DNA"
/organism="synthetic DNA construct"
promoter complement(176..280)
/label="AmpR promoter"
enhancer 546..925
/label="CMV enhancer"
/note="human cytomegalovirus immediate early enhancer"
promoter 926..1128
/label="CMV promoter"
/note="human cytomegalovirus (CMV) immediate early
promoter"
LTR 1143..1323
/label="5' LTR (truncated)"
/note="truncated 5' long terminal repeat (LTR) from HIV-1"
misc_feature 1370..1495
/label="HIV-1 Psi"
/note="packaging signal of human immunodeficiency virus
type 1"
misc_feature 1988..2221
/label="RRE"
/note="The Rev response element (RRE) of HIV-1 allows for
Rev-dependent mRNA export from the nucleus to the
cytoplasm."
CDS 2406..2450
/label="gp41 peptide"
/note="antigenic peptide corresponding to amino acids 655
to 669 of the HIV envelope protein gp41 (Lutje Hulsik et
al., 2013)"
CDS 2599..2640
/note="Protein Tat from Human immunodeficiency virus type 1
group M subtype B (isolate WMJ22). Accession#: P12509"
/label="Protein Tat"
misc_feature 2748..2865
/label="cPPT/CTS"
/note="central polypurine tract and central termination
sequence of HIV-1"
promoter 2916..3156
/label="U6 promoter"
/note="RNA polymerase III promoter for human U6 snRNA"
misc_RNA 5046..5121
/label="gRNA scaffold"
/note="guide RNA scaffold for the Streptococcus pyogenes
CRISPR/Cas9 system"
promoter 5183..5394
/label="EF-1-alpha core promoter"
/note="core promoter for human elongation factor
EF-1-alpha"
CDS 5650..9753
/label="dCas9"
/note="catalytically dead mutant of the Cas9 endonuclease
from the Streptococcus pyogenes Type II CRISPR/Cas system"
CDS 9946..10659
/label="EGFP"
/note="enhanced GFP"
misc_feature 10684..11272
/label="WPRE"
/note="woodchuck hepatitis virus posttranscriptional
regulatory element"
LTR 11344..11577
/label="3' LTR (Delta-U3)"
/note="self-inactivating 3' long terminal repeat (LTR) from
HIV-1"
polyA_signal 11609..11833
/label="bGH poly(A) signal"
/note="bovine growth hormone polyadenylation signal"
rep_origin 11879..12307
/label="f1 ori"
/note="f1 bacteriophage origin of replication; arrow
indicates direction of (+) strand synthesis"
promoter 12321..12650
/label="SV40 promoter"
/note="SV40 enhancer and early promoter"
promoter 12698..12745
/label="EM7 promoter"
/note="synthetic bacterial promoter"
CDS 12764..13135
/label="BleoR"
/note="antibiotic-binding protein"
polyA_signal 13268..13401
/label="SV40 poly(A) signal"
/note="SV40 polyadenylation signal"
promoter complement(13486..13516)
/label="lac promoter"
/note="promoter for the E. coli lac operon"
protein_bind complement(13531..13552)
/label="CAP binding site"
/note="CAP binding activates transcription in the presence
of cAMP."
rep_origin complement(13840..14428)
/direction=LEFT
/label="ori"
/note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
replication"
CDS complement(join(14602..15284,1..175))
/label="AmpR"
/note="beta-lactamase"