Lenti-(BB)-EF1a-KRAB-dCas9-P2A-EGFP vector (V006687)

Price Information

Cat No. Plasmid Name Availability Buy one, get one free! (?)
V006687 Lenti-(BB)-EF1a-KRAB-dCas9-P2A-EGFP In stock, 1 week for quality controls

Two tubes of lyophilized plasmid will be delivered, each tube is about 5µg.

Basic Vector Information

Vector Name:
Lenti-(BB)-EF1a-KRAB-dCas9-P2A-EGFP
Antibiotic Resistance:
Ampicillin
Length:
15284 bp
Type:
Mammalian Expression, Lentiviral, CRISPR
Replication origin:
ori
Copy Number:
High Copy
Promoter:
U6
Cloning Method:
Gibson Cloning
5' Primer:
TAAGAAGTACGGCGGCTTCG

Lenti-(BB)-EF1a-KRAB-dCas9-P2A-EGFP vector Map

Lenti-(BB)-EF1a-KRAB-dCas9-P2A-EGFP15284 bp700140021002800350042004900560063007000770084009100980010500112001190012600133001400014700AmpR promoterCMV enhancerCMV promoter5' LTR (truncated)HIV-1 PsiRREgp41 peptideProtein TatcPPT/CTSU6 promotergRNA scaffoldEF-1-alpha core promoterdCas9EGFPWPRE3' LTR (Delta-U3)bGH poly(A) signalf1 oriSV40 promoterEM7 promoterBleoRSV40 poly(A) signallac promoterCAP binding siteoriAmpR

Plasmid Protocol

1. Centrifuge at 5,000×g for 5 min.

2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.

3. Close the tube and incubate for 10 minutes at room temperature.

4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.

5. Store the plasmid at -20 ℃.

6. The concentration of plasmid re-measurement sometimes differs from the nominal value, which may be due to the position of the lyophilized plasmid in the tube, the efficiency of the re-dissolution, the measurement bias, and adsorption on the wall of the tube, therefore, it is recommended to transform and extract the plasmid before using it

General Plasmid Transform Protocol

1. Take one 100μl of the competent cells and thaw it on ice for 10min, add 2μl of plasmid, then ice bath for 30min, then heat-shock it at 42℃ for 60s, do not stir, and then ice bath for 2min.

2. Add 900μl of LB liquid medium without antibiotics, and incubate at 37℃ for 45min (30℃ for 1-1.5 hours) with 180rpm shaking.

3. Centrifuge at 6000rpm for 5min, leave only 100μl of supernatant to resuspend the bacterial precipitate and spread it onto the target plasmid-resistant LB plate.

4. Invert the plate and incubate at 37℃ for 14h, or at 30℃ for 20h.

5. Pick a single colony into LB liquid medium, add the corresponding antibiotics, incubate at 220rpm for 14h, and extract the plasmid according to the experimental needs and the instructions of the plasmid extraction kit.

Lenti-(BB)-EF1a-KRAB-dCas9-P2A-EGFP vector Sequence

LOCUS       V006687                15284 bp    DNA     circular SYN 13-MAY-2021
DEFINITION  Exported.
ACCESSION   V006687
VERSION     V006687
KEYWORDS    Lenti-(BB)-EF1a-KRAB-dCas9-P2A-EGFP
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
            .
REFERENCE   1  (bases 1 to 15284)
  TITLE     Ferrer Lab Plasmids
REFERENCE   2  (bases 1 to 15284)
  TITLE     Direct Submission
REFERENCE   3  (bases 1 to 15284)
  AUTHORS   .
  TITLE     Direct Submission
COMMENT     SGRef: number: 1; type: "Journal Article"
            SGRef: number: 2; type: "Journal Article"
FEATURES             Location/Qualifiers
     source          1..15284
                     /mol_type="other DNA"
                     /organism="synthetic DNA construct"
     promoter        complement(176..280)
                     /label="AmpR promoter"
     enhancer        546..925
                     /label="CMV enhancer"
                     /note="human cytomegalovirus immediate early enhancer"
     promoter        926..1128
                     /label="CMV promoter"
                     /note="human cytomegalovirus (CMV) immediate early
                     promoter"
     LTR             1143..1323
                     /label="5' LTR (truncated)"
                     /note="truncated 5' long terminal repeat (LTR) from HIV-1"
     misc_feature    1370..1495
                     /label="HIV-1 Psi"
                     /note="packaging signal of human immunodeficiency virus
                     type 1"
     misc_feature    1988..2221
                     /label="RRE"
                     /note="The Rev response element (RRE) of HIV-1 allows for
                     Rev-dependent mRNA export from the nucleus to the
                     cytoplasm."
     CDS             2406..2450
                     /label="gp41 peptide"
                     /note="antigenic peptide corresponding to amino acids 655
                     to 669 of the HIV envelope protein gp41 (Lutje Hulsik et
                     al., 2013)"
     CDS             2599..2640
                     /note="Protein Tat from Human immunodeficiency virus type 1
                     group M subtype B (isolate WMJ22). Accession#: P12509"
                     /label="Protein Tat"
     misc_feature    2748..2865
                     /label="cPPT/CTS"
                     /note="central polypurine tract and central termination
                     sequence of HIV-1"
     promoter        2916..3156
                     /label="U6 promoter"
                     /note="RNA polymerase III promoter for human U6 snRNA"
     misc_RNA        5046..5121
                     /label="gRNA scaffold"
                     /note="guide RNA scaffold for the Streptococcus pyogenes
                     CRISPR/Cas9 system"
     promoter        5183..5394
                     /label="EF-1-alpha core promoter"
                     /note="core promoter for human elongation factor
                     EF-1-alpha"
     CDS             5650..9753
                     /label="dCas9"
                     /note="catalytically dead mutant of the Cas9 endonuclease
                     from the Streptococcus pyogenes Type II CRISPR/Cas system"
     CDS             9946..10659
                     /label="EGFP"
                     /note="enhanced GFP"
     misc_feature    10684..11272
                     /label="WPRE"
                     /note="woodchuck hepatitis virus posttranscriptional
                     regulatory element"
     LTR             11344..11577
                     /label="3' LTR (Delta-U3)"
                     /note="self-inactivating 3' long terminal repeat (LTR) from
                     HIV-1"
     polyA_signal    11609..11833
                     /label="bGH poly(A) signal"
                     /note="bovine growth hormone polyadenylation signal"
     rep_origin      11879..12307
                     /label="f1 ori"
                     /note="f1 bacteriophage origin of replication; arrow
                     indicates direction of (+) strand synthesis"
     promoter        12321..12650
                     /label="SV40 promoter"
                     /note="SV40 enhancer and early promoter"
     promoter        12698..12745
                     /label="EM7 promoter"
                     /note="synthetic bacterial promoter"
     CDS             12764..13135
                     /label="BleoR"
                     /note="antibiotic-binding protein"
     polyA_signal    13268..13401
                     /label="SV40 poly(A) signal"
                     /note="SV40 polyadenylation signal"
     promoter        complement(13486..13516)
                     /label="lac promoter"
                     /note="promoter for the E. coli lac operon"
     protein_bind    complement(13531..13552)
                     /label="CAP binding site"
                     /note="CAP binding activates transcription in the presence
                     of cAMP."
     rep_origin      complement(13840..14428)
                     /direction=LEFT
                     /label="ori"
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
                     replication"
     CDS             complement(join(14602..15284,1..175))
                     /label="AmpR"
                     /note="beta-lactamase"