Price Information
| Cat No. | Plasmid Name | Availability | Add to cart |
|---|---|---|---|
| V006854 | pCA24N-p50-ligase | In stock, instant shipping |
Buy one, get one free! |
Two tubes of lyophilized plasmid will be delivered, each tube is about 5µg.
Basic Vector Information
- Vector Name:
- pCA24N-p50-ligase
- Antibiotic Resistance:
- Chloramphenicol
- Length:
- 7006 bp
- Type:
- Bacterial Expression
- Replication origin:
- ori
- Promoter:
- T5-lac
- Cloning Method:
- Restriction Enzyme
- 5' Primer:
- pCA24N.for (GATAACAATTTCACACAGAATTCATTAAAGAG)
- 3' Primer:
- pCA24N.rev2 — 5'-CAAATCCAGATGGAGTTCTGAGG-3'
pCA24N-p50-ligase vector Map
Plasmid Protocol
1. Centrifuge at 5,000×g for 5 min.
2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.
5. Store the plasmid at -20 ℃.
6. The concentration of plasmid re-measurement sometimes differs from the nominal value, which may be due to the position of the lyophilized plasmid in the tube, the efficiency of the re-dissolution, the measurement bias, and adsorption on the wall of the tube, therefore, it is recommended to transform and extract the plasmid before using it
General Plasmid Transform Protocol
1. Take one 100μl of the competent cells and thaw it on ice for 10min, add 2μl of plasmid, then ice bath for 30min, then heat-shock it at 42℃ for 60s, do not stir, and then ice bath for 2min.
2. Add 900μl of LB liquid medium without antibiotics, and incubate at 37℃ for 45min (30℃ for 1-1.5 hours) with 180rpm shaking.
3. Centrifuge at 6000rpm for 5min, leave only 100μl of supernatant to resuspend the bacterial precipitate and spread it onto the target plasmid-resistant LB plate.
4. Invert the plate and incubate at 37℃ for 14h, or at 30℃ for 20h.
5. Pick a single colony into LB liquid medium, add the corresponding antibiotics, incubate at 220rpm for 14h, and extract the plasmid according to the experimental needs and the instructions of the plasmid extraction kit.
pCA24N-p50-ligase vector Sequence
LOCUS V006854 7006 bp DNA circular SYN 13-MAY-2021
DEFINITION Exported.
ACCESSION V006854
VERSION V006854
KEYWORDS pCA24N-p50-ligase
SOURCE synthetic DNA construct
ORGANISM synthetic DNA construct
.
REFERENCE 1 (bases 1 to 7006)
AUTHORS Wilson RH, Morton SK, Deiderick H, Gerth ML, Paul HA, Gerber I,
Patel A, Ellington AD, Hunicke-Smith SP, Patrick WM
TITLE Engineered DNA ligases with improved activities in vitro.
JOURNAL Protein Eng Des Sel. 2013 Jul;26(7):471-8. doi:
10.1093/protein/gzt024. Epub 2013 Jun 10.
PUBMED 23754529
REFERENCE 2 (bases 1 to 7006)
TITLE Direct Submission
REFERENCE 3 (bases 1 to 7006)
AUTHORS .
TITLE Direct Submission
COMMENT SGRef: number: 1; type: "Journal Article"; doi:
"10.1093/protein/gzt024"; journalName: "Protein Eng Des Sel"; date:
"2013-07"; volume: "26"; issue: "7"; pages: "471-8"
SGRef: number: 2; type: "Journal Article"
FEATURES Location/Qualifiers
source 1..7006
/mol_type="other DNA"
/organism="synthetic DNA construct"
promoter 80..124
/label="T5 promoter"
/note="bacteriophage T5 promoter for E. coli RNA
polymerase, with embedded lac operator"
protein_bind 132..148
/label="lac operator"
/bound_moiety="lac repressor encoded by lacI"
/note="The lac repressor binds to the lac operator to
inhibit transcription in E. coli. This inhibition can be
relieved by adding lactose or
isopropyl-beta-D-thiogalactopyranoside (IPTG)."
RBS 167..178
/note="strong bacterial ribosome binding site (Elowitz and
Leibler, 2000)"
CDS 197..214
/label="6xHis"
/note="6xHis affinity tag"
CDS 1256..2713
/gene="30"
/label="DNA ligase"
/note="DNA ligase from Enterobacteria phage T4. Accession#:
P00970"
terminator 2772..2866
/label="lambda t0 terminator"
/note="transcription terminator from phage lambda"
primer_bind complement(2936..2958)
/label="pGEX 3'"
/note="pGEX vectors, reverse primer"
promoter 3422..3524
/label="cat promoter"
/note="promoter of the E. coli cat gene encoding
chloramphenicol acetyltransferase"
CDS 3525..4181
/label="CmR"
/note="chloramphenicol acetyltransferase"
rep_origin 4735..5323
/label="ori"
/note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
replication"
primer_bind 5477..5494
/label="L4440"
/note="L4440 vector, forward primer"
promoter 5567..5644
/label="lacI promoter"
CDS 5645..6724
/label="lacI"
/note="lac repressor"
protein_bind 6740..6761
/label="CAP binding site"
/note="CAP binding activates transcription in the presence
of cAMP."
promoter 6776..6806
/label="lac promoter"
/note="promoter for the E. coli lac operon"
protein_bind 6814..6830
/label="lac operator"
/bound_moiety="lac repressor encoded by lacI"
/note="The lac repressor binds to the lac operator to
inhibit transcription in E. coli. This inhibition can be
relieved by adding lactose or
isopropyl-beta-D-thiogalactopyranoside (IPTG)."
primer_bind 6838..6854
/label="M13 rev"
/note="common sequencing primer, one of multiple similar
variants"
primer_bind complement(6870..6886)
/label="M13 fwd"
/note="common sequencing primer, one of multiple similar
variants"