Price Information
| Cat No. | Plasmid Name | Availability | Add to cart |
|---|---|---|---|
| V006930 | pgRNA-CKB | In stock, 1 week for quality controls |
Buy one, get one free! |
Two tubes of lyophilized plasmid will be delivered, each tube is about 5µg.
Basic Vector Information
- Vector Name:
- pgRNA-CKB
- Antibiotic Resistance:
- Ampicillin
- Length:
- 9583 bp
- Type:
- Mammalian Expression, Lentiviral, CRISPR
- Replication origin:
- ori
- Selection Marker:
- Blasticidin
- Copy Number:
- High Copy
- Promoter:
- CAG
- Cloning Method:
- Restriction Enzyme
- 5' Primer:
- CCTCTGCTAACCATGTTCATGC
- 3' Primer:
- GATCTACCACATTTGTAGAG
pgRNA-CKB vector Map
Plasmid Protocol
1. Centrifuge at 5,000×g for 5 min.
2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.
5. Store the plasmid at -20 ℃.
6. The concentration of plasmid re-measurement sometimes differs from the nominal value, which may be due to the position of the lyophilized plasmid in the tube, the efficiency of the re-dissolution, the measurement bias, and adsorption on the wall of the tube, therefore, it is recommended to transform and extract the plasmid before using it
General Plasmid Transform Protocol
1. Take one 100μl of the competent cells and thaw it on ice for 10min, add 2μl of plasmid, then ice bath for 30min, then heat-shock it at 42℃ for 60s, do not stir, and then ice bath for 2min.
2. Add 900μl of LB liquid medium without antibiotics, and incubate at 37℃ for 45min (30℃ for 1-1.5 hours) with 180rpm shaking.
3. Centrifuge at 6000rpm for 5min, leave only 100μl of supernatant to resuspend the bacterial precipitate and spread it onto the target plasmid-resistant LB plate.
4. Invert the plate and incubate at 37℃ for 14h, or at 30℃ for 20h.
5. Pick a single colony into LB liquid medium, add the corresponding antibiotics, incubate at 220rpm for 14h, and extract the plasmid according to the experimental needs and the instructions of the plasmid extraction kit.
pgRNA-CKB vector Sequence
LOCUS V006930 9583 bp DNA circular SYN 03-JAN-2022
DEFINITION Exported.
ACCESSION V006930
VERSION V006930
KEYWORDS pgRNA-CKB
SOURCE synthetic DNA construct
ORGANISM synthetic DNA construct
.
REFERENCE 1 (bases 1 to 9583)
AUTHORS Mandegar MA, Huebsch N, Frolov EB, Shin E, Truong A, Olvera MP, Chan
AH, Miyaoka Y, Holmes K, Spencer CI, Judge LM, Gordon DE, Eskildsen
TV, Villalta JE, Horlbeck MA, Gilbert LA, Krogan NJ, Sheikh SP,
Weissman JS, Qi LS, So PL, Conklin BR
TITLE CRISPR Interference Efficiently Induces Specific and Reversible Gene
Silencing in Human iPSCs.
JOURNAL Cell Stem Cell. 2016 Apr 7;18(4):541-53. doi:
10.1016/j.stem.2016.01.022. Epub 2016 Mar 10.
PUBMED 26971820
REFERENCE 2 (bases 1 to 9583)
TITLE Direct Submission
REFERENCE 3 (bases 1 to 9583)
AUTHORS .
TITLE Direct Submission
COMMENT SGRef: number: 1; type: "Journal Article"; doi:
"10.1016/j.stem.2016.01.022"; journalName: "Cell Stem Cell"; date:
"2016-04-7- 7"; volume: "18"; issue: "4"; pages: "541-53"
SGRef: number: 2; type: "Journal Article"
FEATURES Location/Qualifiers
source 1..9583
/mol_type="other DNA"
/organism="synthetic DNA construct"
CDS 160..201
/note="Protein Tat from Human immunodeficiency virus type 1
group M subtype B (isolate WMJ22). Accession#: P12509"
/label="Protein Tat"
misc_feature 309..426
/label="cPPT/CTS"
/note="central polypurine tract and central termination
sequence of HIV-1"
intron 1636..2652
/label="chimeric intron"
/note="chimera between introns from chicken beta-actin and
rabbit beta-globin"
CDS 2717..2737
/label="SV40 NLS"
/note="nuclear localization signal of SV40 (simian virus
40) large T antigen"
CDS 2741..2761
/label="SV40 NLS"
/note="nuclear localization signal of SV40 (simian virus
40) large T antigen"
CDS 2765..2785
/label="SV40 NLS"
/note="nuclear localization signal of SV40 (simian virus
40) large T antigen"
CDS 2801..3496
/label="mKate2"
/note="monomeric far-red fluorescent protein (Shcherbo et
al., 2009)"
CDS 3551..3970
/gene="bsr"
/label="Blasticidin-S deaminase"
/note="Blasticidin-S deaminase from Bacillus cereus.
Accession#: P33967"
protein_bind complement(4248..4281)
/label="loxP"
/note="Cre-mediated recombination occurs in the 8-bp core
sequence (ATGTATGC) (Shaw et al., 2021)."
misc_feature 4337..4925
/label="WPRE"
/note="woodchuck hepatitis virus posttranscriptional
regulatory element"
primer_bind complement(4928..4944)
/label="KS primer"
/note="common sequencing primer, one of multiple similar
variants"
LTR 5454..5634
/label="5' LTR (truncated)"
/note="truncated 5' long terminal repeat (LTR) from HIV-1"
rep_origin complement(5696..6284)
/direction=LEFT
/label="ori"
/note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
replication"
CDS complement(6458..7315)
/label="AmpR"
/note="beta-lactamase"
promoter complement(7316..7420)
/label="AmpR promoter"
enhancer 7686..8065
/label="CMV enhancer"
/note="human cytomegalovirus immediate early enhancer"
promoter 8066..8268
/label="CMV promoter"
/note="human cytomegalovirus (CMV) immediate early
promoter"
misc_feature 8510..8635
/label="HIV-1 Psi"
/note="packaging signal of human immunodeficiency virus
type 1"
misc_feature 9132..9365
/label="RRE"
/note="The Rev response element (RRE) of HIV-1 allows for
Rev-dependent mRNA export from the nucleus to the
cytoplasm."
CDS join(9550..9583,1..11)
/label="gp41 peptide"
/note="antigenic peptide corresponding to amino acids 655
to 669 of the HIV envelope protein gp41 (Lutje Hulsik et
al., 2013)"