Price Information
| Cat No. | Plasmid Name | Availability | Add to cart |
|---|---|---|---|
| V006970 | pLBH531_MBP-Cas14a1 expression | In stock, 1 week for quality controls |
Buy one, get one free! |
Two tubes of lyophilized plasmid will be delivered, each tube is about 5µg.
Basic Vector Information
- Vector Name:
- pLBH531_MBP-Cas14a1 expression
- Antibiotic Resistance:
- Ampicillin
- Length:
- 7556 bp
- Type:
- Bacterial Expression, CRISPR
- Replication origin:
- ori
- Copy Number:
- High Copy
- Promoter:
- tet
- Cloning Method:
- Gibson Cloning
- 5' Primer:
- GATGAAGCCCTGAAAGACGCGCAG
- 3' Primer:
- CTA GTT ATT GCT CAG CGG T
pLBH531_MBP-Cas14a1 expression vector Map
Plasmid Protocol
1. Centrifuge at 5,000×g for 5 min.
2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.
5. Store the plasmid at -20 ℃.
6. The concentration of plasmid re-measurement sometimes differs from the nominal value, which may be due to the position of the lyophilized plasmid in the tube, the efficiency of the re-dissolution, the measurement bias, and adsorption on the wall of the tube, therefore, it is recommended to transform and extract the plasmid before using it
General Plasmid Transform Protocol
1. Take one 100μl of the competent cells and thaw it on ice for 10min, add 2μl of plasmid, then ice bath for 30min, then heat-shock it at 42℃ for 60s, do not stir, and then ice bath for 2min.
2. Add 900μl of LB liquid medium without antibiotics, and incubate at 37℃ for 45min (30℃ for 1-1.5 hours) with 180rpm shaking.
3. Centrifuge at 6000rpm for 5min, leave only 100μl of supernatant to resuspend the bacterial precipitate and spread it onto the target plasmid-resistant LB plate.
4. Invert the plate and incubate at 37℃ for 14h, or at 30℃ for 20h.
5. Pick a single colony into LB liquid medium, add the corresponding antibiotics, incubate at 220rpm for 14h, and extract the plasmid according to the experimental needs and the instructions of the plasmid extraction kit.
pLBH531_MBP-Cas14a1 expression vector Sequence
LOCUS V006970 7556 bp DNA circular SYN 20-DEC-2021
DEFINITION Exported.
ACCESSION V006970
VERSION V006970
KEYWORDS pLBH531_MBP-Cas14a1 expression
SOURCE synthetic DNA construct
ORGANISM synthetic DNA construct
.
REFERENCE 1 (bases 1 to 7556)
AUTHORS Harrington LB, Burstein D, Chen JS, Paez-Espino D, Ma E, Witte IP,
Cofsky JC, Kyrpides NC, Banfield JF, Doudna JA
TITLE Programmed DNA destruction by miniature CRISPR-Cas14 enzymes.
JOURNAL Science. 2018 Oct 18. pii: science.aav4294. doi:
10.1126/science.aav4294.
PUBMED 30337455
REFERENCE 2 (bases 1 to 7556)
TITLE Direct Submission
REFERENCE 3 (bases 1 to 7556)
AUTHORS .
TITLE Direct Submission
COMMENT SGRef: number: 1; type: "Journal Article"; journalName: "Science.
2018 Oct 18. pii: science.aav4294. doi: 10.1126/science.aav4294."
SGRef: number: 2; type: "Journal Article"
FEATURES Location/Qualifiers
source 1..7556
/mol_type="other DNA"
/organism="synthetic DNA construct"
misc_feature 93..232
/label="bom"
/note="basis of mobility region from pBR322"
primer_bind complement(247..264)
/label="L4440"
/note="L4440 vector, forward primer"
rep_origin complement(418..1006)
/direction=LEFT
/label="ori"
/note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
replication"
CDS complement(1180..2037)
/label="AmpR"
/note="beta-lactamase"
promoter complement(2038..2142)
/label="AmpR promoter"
primer_bind 2210..2228
/label="pBRforEco"
/note="pBR322 vectors, upsteam of EcoRI site, forward
primer"
promoter 2255..2283
/label="tet promoter"
/note="E. coli promoter for tetracycline efflux protein
gene"
terminator complement(2649..2696)
/label="T7 terminator"
/note="transcription terminator for bacteriophage T7 RNA
polymerase"
CDS complement(2839..4425)
/gene="cas12f"
/label="CRISPR-associated endodeoxyribonuclease Cas12f1"
/note="CRISPR-associated endodeoxyribonuclease Cas12f1 from
Uncultured archaeon. Accession#: A0A482D308"
CDS complement(4432..4452)
/label="TEV site"
/note="tobacco etch virus (TEV) protease recognition and
cleavage site"
CDS complement(4507..5607)
/label="MBP"
/note="maltose binding protein from E. coli"
CDS complement(5620..5646)
/label="9xHis"
/note="9xHis affinity tag"
RBS complement(5666..5688)
/label="RBS"
/note="efficient ribosome binding site from bacteriophage
T7 gene 10 (Olins and Rangwala, 1989)"
promoter complement(5777..5795)
/label="T7 promoter"
/note="promoter for bacteriophage T7 RNA polymerase"
primer_bind complement(5879..5898)
/label="pBRrevBam"
/note="pBR322 vectors, tet region, downstream of BamHI,
reverse primer"
CDS 7356..7544
/label="rop"
/note="Rop protein, which maintains plasmids at low copy
number"