pLBH531_MBP-Cas14a1 expression vector (V006970)

Price Information

Cat No. Plasmid Name Availability Add to cart
V006970 pLBH531_MBP-Cas14a1 expression In stock, 1 week for quality controls

Buy one, get one free!

Two tubes of lyophilized plasmid will be delivered, each tube is about 5µg.

Basic Vector Information

Vector Name:
pLBH531_MBP-Cas14a1 expression
Antibiotic Resistance:
Ampicillin
Length:
7556 bp
Type:
Bacterial Expression, CRISPR
Replication origin:
ori
Copy Number:
High Copy
Promoter:
tet
Cloning Method:
Gibson Cloning
5' Primer:
GATGAAGCCCTGAAAGACGCGCAG
3' Primer:
CTA GTT ATT GCT CAG CGG T

pLBH531_MBP-Cas14a1 expression vector Map

pLBH531_MBP-Cas14a1 expression7556 bp3006009001200150018002100240027003000330036003900420045004800510054005700600063006600690072007500bomL4440oriAmpRAmpR promoterpBRforEcotet promoterT7 terminatorCRISPR-associated endodeoxyribonuclease Cas12f1TEV siteMBP9xHisRBST7 promoterpBRrevBamrop

Plasmid Protocol

1. Centrifuge at 5,000×g for 5 min.

2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.

3. Close the tube and incubate for 10 minutes at room temperature.

4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.

5. Store the plasmid at -20 ℃.

6. The concentration of plasmid re-measurement sometimes differs from the nominal value, which may be due to the position of the lyophilized plasmid in the tube, the efficiency of the re-dissolution, the measurement bias, and adsorption on the wall of the tube, therefore, it is recommended to transform and extract the plasmid before using it

General Plasmid Transform Protocol

1. Take one 100μl of the competent cells and thaw it on ice for 10min, add 2μl of plasmid, then ice bath for 30min, then heat-shock it at 42℃ for 60s, do not stir, and then ice bath for 2min.

2. Add 900μl of LB liquid medium without antibiotics, and incubate at 37℃ for 45min (30℃ for 1-1.5 hours) with 180rpm shaking.

3. Centrifuge at 6000rpm for 5min, leave only 100μl of supernatant to resuspend the bacterial precipitate and spread it onto the target plasmid-resistant LB plate.

4. Invert the plate and incubate at 37℃ for 14h, or at 30℃ for 20h.

5. Pick a single colony into LB liquid medium, add the corresponding antibiotics, incubate at 220rpm for 14h, and extract the plasmid according to the experimental needs and the instructions of the plasmid extraction kit.

pLBH531_MBP-Cas14a1 expression vector Sequence

LOCUS       V006970                 7556 bp    DNA     circular SYN 20-DEC-2021
DEFINITION  Exported.
ACCESSION   V006970
VERSION     V006970
KEYWORDS    pLBH531_MBP-Cas14a1 expression
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
            .
REFERENCE   1  (bases 1 to 7556)
  AUTHORS   Harrington LB, Burstein D, Chen JS, Paez-Espino D, Ma E, Witte IP,
            Cofsky JC, Kyrpides NC, Banfield JF, Doudna JA
  TITLE     Programmed DNA destruction by miniature CRISPR-Cas14 enzymes.
  JOURNAL   Science. 2018 Oct 18. pii: science.aav4294. doi:
            10.1126/science.aav4294.
   PUBMED   30337455
REFERENCE   2  (bases 1 to 7556)
  TITLE     Direct Submission
REFERENCE   3  (bases 1 to 7556)
  AUTHORS   .
  TITLE     Direct Submission
COMMENT     SGRef: number: 1; type: "Journal Article"; journalName: "Science.
            2018 Oct 18. pii: science.aav4294. doi: 10.1126/science.aav4294."
            SGRef: number: 2; type: "Journal Article"
FEATURES             Location/Qualifiers
     source          1..7556
                     /mol_type="other DNA"
                     /organism="synthetic DNA construct"
     misc_feature    93..232
                     /label="bom"
                     /note="basis of mobility region from pBR322"
     primer_bind     complement(247..264)
                     /label="L4440"
                     /note="L4440 vector, forward primer"
     rep_origin      complement(418..1006)
                     /direction=LEFT
                     /label="ori"
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
                     replication"
     CDS             complement(1180..2037)
                     /label="AmpR"
                     /note="beta-lactamase"
     promoter        complement(2038..2142)
                     /label="AmpR promoter"
     primer_bind     2210..2228
                     /label="pBRforEco"
                     /note="pBR322 vectors, upsteam of EcoRI site, forward
                     primer"
     promoter        2255..2283
                     /label="tet promoter"
                     /note="E. coli promoter for tetracycline efflux protein
                     gene"
     terminator      complement(2649..2696)
                     /label="T7 terminator"
                     /note="transcription terminator for bacteriophage T7 RNA
                     polymerase"
     CDS             complement(2839..4425)
                     /gene="cas12f"
                     /label="CRISPR-associated endodeoxyribonuclease Cas12f1"
                     /note="CRISPR-associated endodeoxyribonuclease Cas12f1 from
                     Uncultured archaeon. Accession#: A0A482D308"
     CDS             complement(4432..4452)
                     /label="TEV site"
                     /note="tobacco etch virus (TEV) protease recognition and
                     cleavage site"
     CDS             complement(4507..5607)
                     /label="MBP"
                     /note="maltose binding protein from E. coli"
     CDS             complement(5620..5646)
                     /label="9xHis"
                     /note="9xHis affinity tag"
     RBS             complement(5666..5688)
                     /label="RBS"
                     /note="efficient ribosome binding site from bacteriophage
                     T7 gene 10 (Olins and Rangwala, 1989)"
     promoter        complement(5777..5795)
                     /label="T7 promoter"
                     /note="promoter for bacteriophage T7 RNA polymerase"
     primer_bind     complement(5879..5898)
                     /label="pBRrevBam"
                     /note="pBR322 vectors, tet region, downstream of BamHI,
                     reverse primer"
     CDS             7356..7544
                     /label="rop"
                     /note="Rop protein, which maintains plasmids at low copy
                     number"