Price Information
| Cat No. | Plasmid Name | Availability | Add to cart |
|---|---|---|---|
| V006982 | pPRIME-TET-GFP-FF3 | In stock, 1 week for quality controls |
Buy one, get one free! |
Two tubes of lyophilized plasmid will be delivered, each tube is about 5µg.
Basic Vector Information
TET promoter (minimal CMV promoter containing seven upstream Tet-operator sites) transcribes GFP and miR30-based shRNA targeting FF3. The FF3 hairpin can be replaced with any other hairpin by cloning into the EcoR1/Xho1 site.Please note that the full plasmid sequence shown here is for the empty vector only and does not contain the FF3 targeting sequence (AGCTCCCGTGAATTGGAATCCTAGTGAAGCCACAGATGTAGGATTCCAATTCAGCGGGAGCC)
- Vector Name:
- pPRIME-TET-GFP-FF3
- Antibiotic Resistance:
- Ampicillin
- Length:
- 8226 bp
- Type:
- Lentiviral vectors
- Replication origin:
- ori
- Copy Number:
- Low copy number
- Promoter:
- tight TRE
- Cloning Method:
- Enzyme digestion and ligation
- 5' Primer:
- EGFP-C Forward: CATGGTCCTGCTGGAGTTCGTG
- Fusion Tag:
- GFP
pPRIME-TET-GFP-FF3 vector Map
Plasmid Protocol
1. Centrifuge at 5,000×g for 5 min.
2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.
5. Store the plasmid at -20 ℃.
6. The concentration of plasmid re-measurement sometimes differs from the nominal value, which may be due to the position of the lyophilized plasmid in the tube, the efficiency of the re-dissolution, the measurement bias, and adsorption on the wall of the tube, therefore, it is recommended to transform and extract the plasmid before using it
General Plasmid Transform Protocol
1. Take one 100μl of the competent cells and thaw it on ice for 10min, add 2μl of plasmid, then ice bath for 30min, then heat-shock it at 42℃ for 60s, do not stir, and then ice bath for 2min.
2. Add 900μl of LB liquid medium without antibiotics, and incubate at 37℃ for 45min (30℃ for 1-1.5 hours) with 180rpm shaking.
3. Centrifuge at 6000rpm for 5min, leave only 100μl of supernatant to resuspend the bacterial precipitate and spread it onto the target plasmid-resistant LB plate.
4. Invert the plate and incubate at 37℃ for 14h, or at 30℃ for 20h.
5. Pick a single colony into LB liquid medium, add the corresponding antibiotics, incubate at 220rpm for 14h, and extract the plasmid according to the experimental needs and the instructions of the plasmid extraction kit.
pPRIME-TET-GFP-FF3 vector Sequence
LOCUS V006982 8226 bp DNA circular SYN 13-JAN-2022
DEFINITION Exported.
ACCESSION V006982
VERSION V006982
KEYWORDS .
SOURCE synthetic DNA construct
ORGANISM synthetic DNA construct
.
REFERENCE 1 (bases 1 to 8226)
TITLE Direct Submission
REFERENCE 2 (bases 1 to 8226)
AUTHORS .
TITLE Direct Submission
COMMENT SGRef: number: 1; type: "Journal Article"
FEATURES Location/Qualifiers
source 1..8226
/mol_type="other DNA"
/organism="synthetic DNA construct"
enhancer 238..617
/label="CMV enhancer"
/note="human cytomegalovirus immediate early enhancer"
misc_feature 1023..1148
/label="HIV-1 Psi"
/note="packaging signal of human immunodeficiency virus
type 1"
misc_feature 1645..1878
/label="RRE"
/note="The Rev response element (RRE) of HIV-1 allows for
Rev-dependent mRNA export from the nucleus to the
cytoplasm."
CDS 2063..2107
/label="gp41 peptide"
/note="antigenic peptide corresponding to amino acids 655
to 669 of the HIV envelope protein gp41 (Lutje Hulsik et
al., 2013)"
CDS 2256..2297
/note="Protein Tat from Human immunodeficiency virus type 1
group M subtype B (isolate WMJ22). Accession#: P12509"
/label="Protein Tat"
misc_feature 2405..2522
/label="cPPT/CTS"
/note="central polypurine tract and central termination
sequence of HIV-1"
promoter 2597..2911
/label="tight TRE promoter"
/note="Tet-responsive promoter PTight, consisting of seven
tet operator sequences followed by the minimal CMV
promoter"
CDS 2928..3644
/label="EGFP"
/note="enhanced GFP"
ncRNA 3697..3790
/label="5' miR-30a"
/note="sequence upstream of the 71-nt precursor of the
human miR-30a microRNA (Zeng et al., 2002)"
ncRNA 3804..3916
/label="3' miR-30a"
/note="sequence downstream of the 71-nt precursor of the
human miR-30a microRNA (Zeng et al., 2002)"
promoter 4069..4171
/label="cat promoter"
/note="promoter of the E. coli cat gene encoding
chloramphenicol acetyltransferase"
CDS 4172..4828
/label="CmR"
/note="chloramphenicol acetyltransferase"
CDS 4963..4992
/label="Myc"
/note="Myc (human c-Myc proto-oncogene) epitope tag"
misc_feature 5115..5703
/label="WPRE"
/note="woodchuck hepatitis virus posttranscriptional
regulatory element"
primer_bind complement(5706..5722)
/label="KS primer"
/note="common sequencing primer, one of multiple similar
variants"
LTR 6232..6412
/label="5' LTR (truncated)"
/note="truncated 5' long terminal repeat (LTR) from HIV-1"
rep_origin complement(6474..7062)
/direction=LEFT
/label="ori"
/note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
replication"
CDS complement(7236..8093)
/label="AmpR"
/note="beta-lactamase"
promoter complement(8094..8198)
/label="AmpR promoter"