Price Information
| Cat No. | Plasmid Name | Availability | Add to cart |
|---|---|---|---|
| V007044 | BASU RaPID plasmid | In stock, 1 week for quality controls |
Buy one, get one free! |
Two tubes of lyophilized plasmid will be delivered, each tube is about 5µg.
Basic Vector Information
- Vector Name:
- BASU RaPID plasmid
- Antibiotic Resistance:
- Ampicillin
- Length:
- 12356 bp
- Type:
- Mammalian Expression, Lentiviral
- Replication origin:
- ori
- Copy Number:
- High Copy
- Promoter:
- SV40
- Cloning Method:
- Gibson Cloning
- 5' Primer:
- CGC AAA TGG GCG GTA GGC GTG
- 3' Primer:
- atatagacaaacgcacaccggcct
BASU RaPID plasmid vector Map
Plasmid Protocol
1. Centrifuge at 5,000×g for 5 min.
2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.
5. Store the plasmid at -20 ℃.
6. The concentration of plasmid re-measurement sometimes differs from the nominal value, which may be due to the position of the lyophilized plasmid in the tube, the efficiency of the re-dissolution, the measurement bias, and adsorption on the wall of the tube, therefore, it is recommended to transform and extract the plasmid before using it
General Plasmid Transform Protocol
1. Take one 100μl of the competent cells and thaw it on ice for 10min, add 2μl of plasmid, then ice bath for 30min, then heat-shock it at 42℃ for 60s, do not stir, and then ice bath for 2min.
2. Add 900μl of LB liquid medium without antibiotics, and incubate at 37℃ for 45min (30℃ for 1-1.5 hours) with 180rpm shaking.
3. Centrifuge at 6000rpm for 5min, leave only 100μl of supernatant to resuspend the bacterial precipitate and spread it onto the target plasmid-resistant LB plate.
4. Invert the plate and incubate at 37℃ for 14h, or at 30℃ for 20h.
5. Pick a single colony into LB liquid medium, add the corresponding antibiotics, incubate at 220rpm for 14h, and extract the plasmid according to the experimental needs and the instructions of the plasmid extraction kit.
BASU RaPID plasmid vector Sequence
LOCUS V007044 12356 bp DNA circular SYN 13-MAY-2021
DEFINITION Exported.
ACCESSION V007044
VERSION V007044
KEYWORDS BASU RaPID plasmid
SOURCE synthetic DNA construct
ORGANISM synthetic DNA construct
.
REFERENCE 1 (bases 1 to 12356)
AUTHORS Ramanathan M, Majzoub K, Rao DS, Neela PH, Zarnegar BJ, Mondal S,
Roth JG, Gai H, Kovalski JR, Siprashvili Z, Palmer TD, Carette JE,
Khavari PA
TITLE RNA-protein interaction detection in living cells.
JOURNAL Nat Methods. 2018 Feb 5. pii: nmeth.4601. doi: 10.1038/nmeth.4601.
PUBMED 29400715
REFERENCE 2 (bases 1 to 12356)
TITLE Direct Submission
REFERENCE 3 (bases 1 to 12356)
AUTHORS .
TITLE Direct Submission
COMMENT SGRef: number: 1; type: "Journal Article"; journalName: "Nat
Methods. 2018 Feb 5. pii: nmeth.4601. doi: 10.1038/nmeth.4601."
SGRef: number: 2; type: "Journal Article"
FEATURES Location/Qualifiers
source 1..12356
/mol_type="other DNA"
/organism="synthetic DNA construct"
LTR 1..634
/label="3' LTR"
/note="3' long terminal repeat (LTR) from HIV-1"
misc_feature 681..806
/label="HIV-1 Psi"
/note="packaging signal of human immunodeficiency virus
type 1"
misc_feature 1303..1536
/label="RRE"
/note="The Rev response element (RRE) of HIV-1 allows for
Rev-dependent mRNA export from the nucleus to the
cytoplasm."
CDS 1721..1765
/label="gp41 peptide"
/note="antigenic peptide corresponding to amino acids 655
to 669 of the HIV envelope protein gp41 (Lutje Hulsik et
al., 2013)"
CDS 1914..1955
/note="Protein Tat from Human immunodeficiency virus type 1
group M subtype B (isolate WMJ22). Accession#: P12509"
/label="Protein Tat"
misc_feature 2063..2180
/label="cPPT/CTS"
/note="central polypurine tract and central termination
sequence of HIV-1"
CDS complement(2248..2619)
/label="BleoR"
/note="antibiotic-binding protein"
promoter complement(2639..2686)
/label="EM7 promoter"
/note="synthetic bacterial promoter"
enhancer 2791..3094
/label="CMV enhancer"
/note="human cytomegalovirus immediate early enhancer"
promoter 3095..3298
/label="CMV promoter"
/note="human cytomegalovirus (CMV) immediate early
promoter"
primer_bind 3295..3319
/label="LNCX"
/note="Human CMV promoter, forward primer"
CDS 3492..3518
/label="NES"
/note="nuclear export signal from the HIV Rev protein
(Fischer et al., 1995)"
CDS 3528..3554
/label="HA"
/note="HA (human influenza hemagglutinin) epitope tag"
misc_feature 4358..4940
/label="IRES2"
/note="internal ribosome entry site (IRES) of the
encephalomyocarditis virus (EMCV)"
CDS 4939..5532
/label="PuroR"
/note="puromycin N-acetyltransferase"
CDS 5542..5595
/codon_start=1
/product="2A peptide from Thosea asigna virus capsid
protein"
/label="T2A"
/note="Eukaryotic ribosomes fail to insert a peptide bond
between the Gly and Pro residues, yielding separate
polypeptides."
/translation="EGRGSLLTCGDVEENPGP"
CDS 5608..6315
/label="mCherry"
/note="monomeric derivative of DsRed fluorescent protein
(Shaner et al., 2004)"
misc_feature 6331..6919
/label="WPRE"
/note="woodchuck hepatitis virus posttranscriptional
regulatory element"
LTR 7126..7359
/label="3' LTR (Delta-U3)"
/note="self-inactivating 3' long terminal repeat (LTR) from
HIV-1"
polyA_signal 7466..7690
/label="bGH poly(A) signal"
/note="bovine growth hormone polyadenylation signal"
rep_origin 7736..8164
/label="f1 ori"
/note="f1 bacteriophage origin of replication; arrow
indicates direction of (+) strand synthesis"
promoter 8178..8507
/label="SV40 promoter"
/note="SV40 enhancer and early promoter"
CDS 8556..9578
/label="HygR"
/note="aminoglycoside phosphotransferase from E. coli"
polyA_signal 9711..9844
/label="SV40 poly(A) signal"
/note="SV40 polyadenylation signal"
primer_bind complement(9881..9897)
/label="M13 rev"
/note="common sequencing primer, one of multiple similar
variants"
primer_bind complement(9881..9897)
/label="M13 Reverse"
/note="In lacZ gene. Also called M13-rev"
primer_bind complement(9894..9916)
/label="M13/pUC Reverse"
/note="In lacZ gene"
protein_bind 9905..9921
/label="lac operator"
/bound_moiety="lac repressor encoded by lacI"
/note="The lac repressor binds to the lac operator to
inhibit transcription in E. coli. This inhibition can be
relieved by adding lactose or
isopropyl-beta-D-thiogalactopyranoside (IPTG)."
promoter complement(9929..9959)
/label="lac promoter"
/note="promoter for the E. coli lac operon"
protein_bind complement(9974..9995)
/label="CAP binding site"
/note="CAP binding activates transcription in the presence
of cAMP."
primer_bind complement(10112..10129)
/label="L4440"
/note="L4440 vector, forward primer"
rep_origin complement(10283..10871)
/direction=LEFT
/label="ori"
/note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
replication"
CDS complement(11045..11902)
/label="AmpR"
/note="beta-lactamase"
promoter complement(11903..12007)
/label="AmpR promoter"
polyA_signal 12055..12189
/label="SV40 poly(A) signal"
/note="SV40 polyadenylation signal"