Price Information
Cat No. | Plasmid Name | Availability | Add to cart |
---|---|---|---|
V007087 | pCDH-CMV-MCS-EF1-copGFP | In stock, instant shipping |
Buy one, get one free! |
Two tubes of lyophilized plasmid will be delivered, each tube is about 5µg.
Basic Vector Information
The hEF1a promoter and the HTLV 5'LTR forms a composite promoter. hEF1a-HTLV promoter is a composite promoter comprising the human Elongation Factor-1α(EF-1α) core promoter and the R segment and part of the U5 sequence (R-U5’) of the Human T-Cell Leukemia Virus (HTLV) Type 1 Long Terminal Repeat. The EF-1α promoter exhibits a strong activity and yields long lasting expression of a transgene in vivo. The R-U5’ has been coupled to the EF-1α core promoter to enhance stability of RNA.
- Vector Name:
- pCDH-CMV-MCS-EF1-copGFP
- Antibiotic Resistance:
- Ampicillin
- Length:
- 7546 bp
- Type:
- Lentiviral vectors
- Replication origin:
- ori
- Promoter:
- RSV
- Cloning Method:
- Enzyme digestion and ligation
- 5' Primer:
- CMV-F: CGCAAATGGGCGGTAGGCGTG
- Fusion Tag:
- copGFP
pCDH-CMV-MCS-EF1-copGFP vector Map
Plasmid Protocol
1. Centrifuge at 5,000×g for 5 min.
2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.
5. Store the plasmid at -20 ℃.
6. The concentration of plasmid re-measurement sometimes differs from the nominal value, which may be due to the position of the lyophilized plasmid in the tube, the efficiency of the re-dissolution, the measurement bias, and adsorption on the wall of the tube, therefore, it is recommended to transform and extract the plasmid before using it
General Plasmid Transform Protocol
1. Take one 100μl of the competent cells and thaw it on ice for 10min, add 2μl of plasmid, then ice bath for 30min, then heat-shock it at 42℃ for 60s, do not stir, and then ice bath for 2min.
2. Add 900μl of LB liquid medium without antibiotics, and incubate at 37℃ for 45min (30℃ for 1-1.5 hours) with 180rpm shaking.
3. Centrifuge at 6000rpm for 5min, leave only 100μl of supernatant to resuspend the bacterial precipitate and spread it onto the target plasmid-resistant LB plate.
4. Invert the plate and incubate at 37℃ for 14h, or at 30℃ for 20h.
5. Pick a single colony into LB liquid medium, add the corresponding antibiotics, incubate at 220rpm for 14h, and extract the plasmid according to the experimental needs and the instructions of the plasmid extraction kit.
pCDH-CMV-MCS-EF1-copGFP vector Sequence
LOCUS V007087 7546 bp DNA circular SYN 13-JAN-2022 DEFINITION Exported. ACCESSION V007087 VERSION V007087 KEYWORDS . SOURCE synthetic DNA construct ORGANISM synthetic DNA construct . REFERENCE 1 (bases 1 to 7546) TITLE Direct Submission REFERENCE 2 (bases 1 to 7546) AUTHORS . TITLE Direct Submission COMMENT SGRef: number: 1; type: "Journal Article" FEATURES Location/Qualifiers source 1..7546 /mol_type="other DNA" /organism="synthetic DNA construct" promoter 6..233 /label="RSV promoter" /note="Rous sarcoma virus enhancer/promoter" LTR 234..414 /label="5' LTR (truncated)" /note="truncated 5' long terminal repeat (LTR) from HIV-1" misc_feature 458..583 /label="HIV-1 Psi" /note="packaging signal of human immunodeficiency virus type 1" misc_feature 1076..1309 /label="RRE" /note="The Rev response element (RRE) of HIV-1 allows for Rev-dependent mRNA export from the nucleus to the cytoplasm." CDS 1493..1537 /label="gp41 peptide" /note="antigenic peptide corresponding to amino acids 655 to 669 of the HIV envelope protein gp41 (Lutje Hulsik et al., 2013)" CDS 1686..1727 /note="Protein Tat from Human immunodeficiency virus type 1 group M subtype B (isolate WMJ22). Accession#: P12509" /label="Protein Tat" misc_feature 1798..1915 /label="cPPT/CTS" /note="central polypurine tract and central termination sequence of HIV-1" promoter 2005..2208 /label="CMV promoter" /note="human cytomegalovirus (CMV) immediate early promoter" promoter 2349..2560 /label="EF-1-alpha core promoter" /note="core promoter for human elongation factor EF-1-alpha" LTR 2573..2841 /label="5' LTR (truncated)" /note="truncated 5' long terminal repeat (LTR) from human T-cell leukemia virus (HTLV) type 1" CDS 2897..3562 /label="CopGFP" /note="green fluorescent protein 2 from Pontellina plumata, also known as ppluGFP2 (Shagin et al., 2004)" misc_feature 3641..4229 /label="WPRE" /note="woodchuck hepatitis virus posttranscriptional regulatory element" LTR 4303..4536 /label="3' LTR (Delta-U3)" /note="self-inactivating 3' long terminal repeat (LTR) from HIV-1" polyA_signal 4608..4742 /label="SV40 poly(A) signal" /note="SV40 polyadenylation signal" rep_origin 4748..4883 /label="SV40 ori" /note="SV40 origin of replication" primer_bind complement(4921..4937) /label="M13 rev" /note="common sequencing primer, one of multiple similar variants" protein_bind complement(4945..4961) /label="lac operator" /note="The lac repressor binds to the lac operator to inhibit transcription in E. coli. This inhibition can be relieved by adding lactose or isopropyl-beta-D-thiogalactopyranoside (IPTG)." promoter complement(4969..4999) /label="lac promoter" /note="promoter for the E. coli lac operon" protein_bind complement(5014..5035) /label="CAP binding site" /note="CAP binding activates transcription in the presence of cAMP." rep_origin complement(5323..5911) /direction=LEFT /label="ori" /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of replication" CDS complement(6085..6942) /label="AmpR" /note="beta-lactamase" promoter complement(6943..7047) /label="AmpR promoter" primer_bind 7521..7537 /label="M13 fwd" /note="common sequencing primer, one of multiple similar variants"