Price Information
Cat No. | Plasmid Name | Availability | Add to cart |
---|---|---|---|
V007142 | pACBSR-hyg | In stock, instant shipping |
Buy one, get one free! |
Two tubes of lyophilized plasmid will be delivered, each tube is about 5µg.
Basic Vector Information
- Vector Name:
- pACBSR-hyg
- Antibiotic Resistance:
- Hygromycin
- Length:
- 7660 bp
- Type:
- Bacterial Expression
- Replication origin:
- p15A ori
- Promoter:
- araBAD
- Cloning Method:
- Restriction Enzyme
- 5' Primer:
- AGATCTCGGGGAAATGTGCGCGGAAC
- 3' Primer:
- CTCGAGGTATATATGAGTAAACTTGGTCTG
- Growth Strain(s):
- DH5alpha
- Growth Temperature:
- 30℃
pACBSR-hyg vector Map
Plasmid Protocol
1. Centrifuge at 5,000×g for 5 min.
2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.
5. Store the plasmid at -20 ℃.
6. The concentration of plasmid re-measurement sometimes differs from the nominal value, which may be due to the position of the lyophilized plasmid in the tube, the efficiency of the re-dissolution, the measurement bias, and adsorption on the wall of the tube, therefore, it is recommended to transform and extract the plasmid before using it
General Plasmid Transform Protocol
1. Take one 100μl of the competent cells and thaw it on ice for 10min, add 2μl of plasmid, then ice bath for 30min, then heat-shock it at 42℃ for 60s, do not stir, and then ice bath for 2min.
2. Add 900μl of LB liquid medium without antibiotics, and incubate at 37℃ for 45min (30℃ for 1-1.5 hours) with 180rpm shaking.
3. Centrifuge at 6000rpm for 5min, leave only 100μl of supernatant to resuspend the bacterial precipitate and spread it onto the target plasmid-resistant LB plate.
4. Invert the plate and incubate at 37℃ for 14h, or at 30℃ for 20h.
5. Pick a single colony into LB liquid medium, add the corresponding antibiotics, incubate at 220rpm for 14h, and extract the plasmid according to the experimental needs and the instructions of the plasmid extraction kit.
pACBSR-hyg vector Sequence
LOCUS V007142 7660 bp DNA circular SYN 13-MAY-2021 DEFINITION Exported. ACCESSION V007142 VERSION V007142 KEYWORDS pACBSR-hyg SOURCE synthetic DNA construct ORGANISM synthetic DNA construct . REFERENCE 1 (bases 1 to 7660) AUTHORS Huang TW, Lam I, Chang HY, Tsai SF, Palsson BO, Charusanti P TITLE Capsule deletion via a lambda-Red knockout system perturbs biofilm formation and fimbriae expression in Klebsiella pneumoniae MGH 78578. JOURNAL BMC Res Notes. 2014 Jan 8;7:13. doi: 10.1186/1756-0500-7-13. PUBMED 24398052 REFERENCE 2 (bases 1 to 7660) TITLE Direct Submission REFERENCE 3 (bases 1 to 7660) AUTHORS . TITLE Direct Submission COMMENT SGRef: number: 1; type: "Journal Article"; journalName: "BMC Res Notes."; date: "2014-01-8"; pages: " 10.1186/1756-0500-7-13" SGRef: number: 2; type: "Journal Article" FEATURES Location/Qualifiers source 1..7660 /mol_type="other DNA" /organism="synthetic DNA construct" promoter complement(461..745) /label="araBAD promoter" /note="promoter of the L-arabinose operon of E. coli; the araC regulatory gene is transcribed in the opposite direction (Guzman et al., 1995)" CDS 772..1647 /label="araC" /note="L-arabinose regulatory protein" CDS complement(2299..3321) /label="HygR" /note="aminoglycoside phosphotransferase from E. coli" promoter complement(3322..3426) /label="AmpR promoter" rep_origin complement(3863..4408) /direction=LEFT /label="p15A ori" /note="Plasmids containing the medium-copy-number p15A origin of replication can be propagated in E. coli cells that contain a second plasmid with the ColE1 origin." promoter complement(4658..4749) /label="AmpR promoter" terminator complement(4768..4795) /label="rrnB T2 terminator" /note="transcription terminator T2 from the E. coli rrnB gene" terminator complement(4887..4973) /label="rrnB T1 terminator" /note="transcription terminator T1 from the E. coli rrnB gene" terminator complement(5203..5447) /label="lambda tL3 terminator" /note="transcription terminator tL3 from phage lambda" CDS complement(5451..6128) /label="Exo" /note="5' to 3' double-stranded DNA exonuclease in the lambda Red system" CDS complement(6128..6910) /label="Beta" /note="single-stranded DNA binding recombinase in the lambda Red system" CDS complement(6919..7332) /label="Gam" /note="inhibitor of the host RecBCD nuclease in the lambda Red system" CDS complement(join(7376..7660,1..420)) /gene="SCEI" /label="Intron-encoded endonuclease I-SceI" /note="Intron-encoded endonuclease I-SceI from Saccharomyces cerevisiae (strain ATCC 204508 / S288c). Accession#: P03882"