pACBSR-hyg vector (V007142)

COA reports Sequencing Results MSDS Download GenBank File(.gb)

Price Information

Cat No.	Plasmid Name	Availability	Add to cart
V007142	pACBSR-hyg	In stock, instant shipping	Buy one, get one free!

Two tubes of lyophilized plasmid will be delivered, each tube is about 5µg.

Basic Vector Information

Vector Name:: pACBSR-hyg

Antibiotic Resistance:: Hygromycin

Length:: 7660 bp

Type:: Bacterial Expression

Replication origin:: p15A ori

Promoter:: araBAD

Cloning Method:: Restriction Enzyme

5' Primer:: AGATCTCGGGGAAATGTGCGCGGAAC

3' Primer:: CTCGAGGTATATATGAGTAAACTTGGTCTG

Growth Strain(s):: DH5alpha

Growth Temperature:: 30℃

pACBSR-hyg vector Map

Copy Sequence View Map

Plasmid Protocol

1. Centrifuge at 5,000×g for 5 min.

2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.

3. Close the tube and incubate for 10 minutes at room temperature.

4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.

5. Store the plasmid at -20 ℃.

6. The concentration of plasmid re-measurement sometimes differs from the nominal value, which may be due to the position of the lyophilized plasmid in the tube, the efficiency of the re-dissolution, the measurement bias, and adsorption on the wall of the tube, therefore, it is recommended to transform and extract the plasmid before using it

General Plasmid Transform Protocol

1. Take one 100μl of the competent cells and thaw it on ice for 10min, add 2μl of plasmid, then ice bath for 30min, then heat-shock it at 42℃ for 60s, do not stir, and then ice bath for 2min.

2. Add 900μl of LB liquid medium without antibiotics, and incubate at 37℃ for 45min (30℃ for 1-1.5 hours) with 180rpm shaking.

3. Centrifuge at 6000rpm for 5min, leave only 100μl of supernatant to resuspend the bacterial precipitate and spread it onto the target plasmid-resistant LB plate.

4. Invert the plate and incubate at 37℃ for 14h, or at 30℃ for 20h.

5. Pick a single colony into LB liquid medium, add the corresponding antibiotics, incubate at 220rpm for 14h, and extract the plasmid according to the experimental needs and the instructions of the plasmid extraction kit.

pACBSR-hyg vector Sequence

LOCUS       V007142                 7660 bp    DNA     circular SYN 13-MAY-2021
DEFINITION  Exported.
ACCESSION   V007142
VERSION     V007142
KEYWORDS    pACBSR-hyg
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
            .
REFERENCE   1  (bases 1 to 7660)
  AUTHORS   Huang TW, Lam I, Chang HY, Tsai SF, Palsson BO, Charusanti P
  TITLE     Capsule deletion via a lambda-Red knockout system perturbs biofilm
            formation and fimbriae expression in Klebsiella pneumoniae MGH
            78578.
  JOURNAL   BMC Res Notes. 2014 Jan 8;7:13. doi: 10.1186/1756-0500-7-13.
   PUBMED   24398052
REFERENCE   2  (bases 1 to 7660)
  TITLE     Direct Submission
REFERENCE   3  (bases 1 to 7660)
  AUTHORS   .
  TITLE     Direct Submission
COMMENT     SGRef: number: 1; type: "Journal Article"; journalName: "BMC Res
            Notes."; date: "2014-01-8"; pages: "
            10.1186/1756-0500-7-13"
            SGRef: number: 2; type: "Journal Article"
FEATURES             Location/Qualifiers
     source          1..7660
                     /mol_type="other DNA"
                     /organism="synthetic DNA construct"
     promoter        complement(461..745)
                     /label="araBAD promoter"
                     /note="promoter of the L-arabinose operon of E. coli; the
                     araC regulatory gene is transcribed in the opposite
                     direction (Guzman et al., 1995)"
     CDS             772..1647
                     /label="araC"
                     /note="L-arabinose regulatory protein"
     CDS             complement(2299..3321)
                     /label="HygR"
                     /note="aminoglycoside phosphotransferase from E. coli"
     promoter        complement(3322..3426)
                     /label="AmpR promoter"
     rep_origin      complement(3863..4408)
                     /direction=LEFT
                     /label="p15A ori"
                     /note="Plasmids containing the medium-copy-number p15A
                     origin of replication can be propagated in E. coli cells
                     that contain a second plasmid with the ColE1 origin."
     promoter        complement(4658..4749)
                     /label="AmpR promoter"
     terminator      complement(4768..4795)
                     /label="rrnB T2 terminator"
                     /note="transcription terminator T2 from the E. coli rrnB
                     gene"
     terminator      complement(4887..4973)
                     /label="rrnB T1 terminator"
                     /note="transcription terminator T1 from the E. coli rrnB
                     gene"
     terminator      complement(5203..5447)
                     /label="lambda tL3 terminator"
                     /note="transcription terminator tL3 from phage lambda"
     CDS             complement(5451..6128)
                     /label="Exo"
                     /note="5' to 3' double-stranded DNA exonuclease in the
                     lambda Red system"
     CDS             complement(6128..6910)
                     /label="Beta"
                     /note="single-stranded DNA binding recombinase in the
                     lambda Red system"
     CDS             complement(6919..7332)
                     /label="Gam"
                     /note="inhibitor of the host RecBCD nuclease in the lambda
                     Red system"
     CDS             complement(join(7376..7660,1..420))
                     /gene="SCEI"
                     /label="Intron-encoded endonuclease I-SceI"
                     /note="Intron-encoded endonuclease I-SceI from
                     Saccharomyces cerevisiae (strain ATCC 204508 / S288c).
                     Accession#: P03882"