Cart 2

pLBH559_Tet-HisCas14a1Locus vector (V007150)

Price Information

Cat No. Plasmid Name Availability Add to cart
V007150 pLBH559_Tet-HisCas14a1Locus In stock, 1 week for quality controls

Buy one, get one free!

Two tubes of lyophilized plasmid will be delivered, each tube is about 5µg.

Basic Vector Information

Vector Name:
pLBH559_Tet-HisCas14a1Locus
Antibiotic Resistance:
Chloramphenicol
Length:
4670 bp
Type:
Bacterial Expression, CRISPR
Replication origin:
p15A ori
Copy Number:
Low Copy
Promoter:
Tet
Cloning Method:
Gibson Cloning
5' Primer:
gtgccgatcaacgtAtcattttcg
3' Primer:
acgcagaaaggcccacccgaag

pLBH559_Tet-HisCas14a1Locus vector Map

Copy Sequence View Map
pLBH559_Tet-HisCas14a1Locus4670 bp600120018002400300036004200tetR/tetA promotersRBS6xHisTEV siteCRISPR-associated endodeoxyribonuclease Cas12f1T7Te terminatorL4440p15A orilambda t0 terminatorCmRcat promoterTetR

Plasmid Protocol

1. Centrifuge at 5,000×g for 5 min.

2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.

3. Close the tube and incubate for 10 minutes at room temperature.

4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.

5. Store the plasmid at -20 ℃.

6. The concentration of plasmid re-measurement sometimes differs from the nominal value, which may be due to the position of the lyophilized plasmid in the tube, the efficiency of the re-dissolution, the measurement bias, and adsorption on the wall of the tube, therefore, it is recommended to transform and extract the plasmid before using it

General Plasmid Transform Protocol

1. Take one 100μl of the competent cells and thaw it on ice for 10min, add 2μl of plasmid, then ice bath for 30min, then heat-shock it at 42℃ for 60s, do not stir, and then ice bath for 2min.

2. Add 900μl of LB liquid medium without antibiotics, and incubate at 37℃ for 45min (30℃ for 1-1.5 hours) with 180rpm shaking.

3. Centrifuge at 6000rpm for 5min, leave only 100μl of supernatant to resuspend the bacterial precipitate and spread it onto the target plasmid-resistant LB plate.

4. Invert the plate and incubate at 37℃ for 14h, or at 30℃ for 20h.

5. Pick a single colony into LB liquid medium, add the corresponding antibiotics, incubate at 220rpm for 14h, and extract the plasmid according to the experimental needs and the instructions of the plasmid extraction kit.

pLBH559_Tet-HisCas14a1Locus vector Sequence

LOCUS       V007150                 4670 bp    DNA     circular SYN 13-MAY-2021
DEFINITION  Exported.
ACCESSION   V007150
VERSION     V007150
KEYWORDS    pLBH559_Tet-HisCas14a1Locus
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
            .
REFERENCE   1  (bases 1 to 4670)
  AUTHORS   Harrington LB, Burstein D, Chen JS, Paez-Espino D, Ma E, Witte IP,
            Cofsky JC, Kyrpides NC, Banfield JF, Doudna JA
  TITLE     Programmed DNA destruction by miniature CRISPR-Cas14 enzymes.
  JOURNAL   Science. 2018 Oct 18. pii: science.aav4294. doi:
            10.1126/science.aav4294.
   PUBMED   30337455
REFERENCE   2  (bases 1 to 4670)
  TITLE     Direct Submission
REFERENCE   3  (bases 1 to 4670)
  AUTHORS   .
  TITLE     Direct Submission
COMMENT     SGRef: number: 1; type: "Journal Article"; journalName: "Science.
            2018 Oct 18. pii: science.aav4294. doi: 10.1126/science.aav4294."
            SGRef: number: 2; type: "Journal Article"
FEATURES             Location/Qualifiers
     source          1..4670
                     /mol_type="other DNA"
                     /organism="synthetic DNA construct"
     promoter        16..71
                     /label="tetR/tetA promoters"
                     /note="overlapping promoters for bacterial tetR and tetA"
     RBS             89..100
                     /note="strong bacterial ribosome binding site (Elowitz and
                     Leibler, 2000)"
     CDS             116..133
                     /label="6xHis"
                     /note="6xHis affinity tag"
     CDS             134..154
                     /label="TEV site"
                     /note="tobacco etch virus (TEV) protease recognition and
                     cleavage site"
     CDS             170..1756
                     /gene="cas12f"
                     /label="CRISPR-associated endodeoxyribonuclease Cas12f1"
                     /note="CRISPR-associated endodeoxyribonuclease Cas12f1 from
                     Uncultured archaeon. Accession#: A0A482D308"
     terminator      2289..2316
                     /label="T7Te terminator"
                     /note="phage T7 early transcription terminator"
     primer_bind     complement(2344..2361)
                     /label="L4440"
                     /note="L4440 vector, forward primer"
     rep_origin      complement(2478..3023)
                     /direction=LEFT
                     /label="p15A ori"
                     /note="Plasmids containing the medium-copy-number p15A
                     origin of replication can be propagated in E. coli cells
                     that contain a second plasmid with the ColE1 origin."
     terminator      complement(3137..3231)
                     /label="lambda t0 terminator"
                     /note="transcription terminator from phage lambda"
     CDS             complement(3255..3911)
                     /label="CmR"
                     /note="chloramphenicol acetyltransferase"
     promoter        complement(3912..4014)
                     /label="cat promoter"
                     /note="promoter of the E. coli cat gene encoding
                     chloramphenicol acetyltransferase"
     CDS             complement(4047..4670)
                     /label="TetR"
                     /note="tetracycline repressor TetR"