Price Information
Cat No. | Plasmid Name | Availability | Add to cart |
---|---|---|---|
V012108 | pLJC5-3XHA-EGFP-PEX26 | In stock, 1 week for quality controls |
Buy one, get one free! |
Two tubes of lyophilized plasmid will be delivered, each tube is about 5µg.
Basic Vector Information
- Vector Name:
- pLJC5-3XHA-EGFP-PEX26
- Antibiotic Resistance:
- Ampicillin
- Length:
- 9076 bp
- Type:
- Lentiviral
- Replication origin:
- ori
- Selection Marker:
- Puromycin
- Promoter:
- UbC
- Cloning Method:
- Restriction Enzyme
- 5' Primer:
- TGAAGCTCCGGTTTTGAACT
pLJC5-3XHA-EGFP-PEX26 vector Map
Plasmid Protocol
1. Centrifuge at 5,000×g for 5 min.
2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.
5. Store the plasmid at -20 ℃.
6. The concentration of plasmid re-measurement sometimes differs from the nominal value, which may be due to the position of the lyophilized plasmid in the tube, the efficiency of the re-dissolution, the measurement bias, and adsorption on the wall of the tube, therefore, it is recommended to transform and extract the plasmid before using it
General Plasmid Transform Protocol
1. Take one 100μl of the competent cells and thaw it on ice for 10min, add 2μl of plasmid, then ice bath for 30min, then heat-shock it at 42℃ for 60s, do not stir, and then ice bath for 2min.
2. Add 900μl of LB liquid medium without antibiotics, and incubate at 37℃ for 45min (30℃ for 1-1.5 hours) with 180rpm shaking.
3. Centrifuge at 6000rpm for 5min, leave only 100μl of supernatant to resuspend the bacterial precipitate and spread it onto the target plasmid-resistant LB plate.
4. Invert the plate and incubate at 37℃ for 14h, or at 30℃ for 20h.
5. Pick a single colony into LB liquid medium, add the corresponding antibiotics, incubate at 220rpm for 14h, and extract the plasmid according to the experimental needs and the instructions of the plasmid extraction kit.
pLJC5-3XHA-EGFP-PEX26 vector Sequence
LOCUS V012108 9076 bp DNA circular SYN 13-MAY-2021 DEFINITION Exported. ACCESSION V012108 VERSION V012108 KEYWORDS pLJC5-3XHA-EGFP-PEX26 SOURCE synthetic DNA construct ORGANISM synthetic DNA construct . REFERENCE 1 (bases 1 to 9076) AUTHORS Ray GJ, Boydston EA, Shortt E, Wyant GA, Lourido S, Chen WW, Sabatini DM TITLE A PEROXO-Tag enables rapid isolation of peroxisomes from human cells JOURNAL iScience, ISSN: 2589-0042, Vol: 0, Issue: 0, Page: 101109 REFERENCE 2 (bases 1 to 9076) TITLE Direct Submission REFERENCE 3 (bases 1 to 9076) AUTHORS . TITLE Direct Submission COMMENT SGRef: number: 1; type: "Journal Article"; journalName: "iScience, ISSN: 2589-0042, Vol: 0, Issue: 0, Page: 101109" SGRef: number: 2; type: "Journal Article" FEATURES Location/Qualifiers source 1..9076 /mol_type="other DNA" /organism="synthetic DNA construct" promoter 1..227 /label="RSV promoter" /note="Rous sarcoma virus enhancer/promoter" LTR 228..408 /label="5' LTR (truncated)" /note="truncated 5' long terminal repeat (LTR) from HIV-1" misc_feature 455..580 /label="HIV-1 Psi" /note="packaging signal of human immunodeficiency virus type 1" misc_feature 1073..1306 /label="RRE" /note="The Rev response element (RRE) of HIV-1 allows for Rev-dependent mRNA export from the nucleus to the cytoplasm." CDS 1491..1535 /label="gp41 peptide" /note="antigenic peptide corresponding to amino acids 655 to 669 of the HIV envelope protein gp41 (Lutje Hulsik et al., 2013)" CDS 1684..1725 /note="Protein Tat from Human immunodeficiency virus type 1 group M subtype B (isolate WMJ22). Accession#: P12509" /label="Protein Tat" promoter 1824..3035 /label="UbC promoter" /note="human ubiquitin C promoter" CDS 3073..3099 /label="HA" /note="HA (human influenza hemagglutinin) epitope tag" CDS 3112..3138 /label="HA" /note="HA (human influenza hemagglutinin) epitope tag" CDS 3151..3177 /label="HA" /note="HA (human influenza hemagglutinin) epitope tag" CDS 3190..3903 /label="mEGFP" /note="enhanced GFP with monomerizing A206K mutation (Zacharias et al., 2002)" misc_feature 4170..4287 /label="cPPT/CTS" /note="central polypurine tract and central termination sequence of HIV-1" promoter 4336..4846 /label="hPGK promoter" /note="human phosphoglycerate kinase 1 promoter" CDS 4868..5464 /label="PuroR" /note="puromycin N-acetyltransferase" LTR 5595..5828 /label="3' LTR (Delta-U3)" /note="self-inactivating 3' long terminal repeat (LTR) from HIV-1" polyA_signal 5900..6034 /label="SV40 poly(A) signal" /note="SV40 polyadenylation signal" rep_origin 6061..6196 /label="SV40 ori" /note="SV40 origin of replication" promoter complement(6217..6235) /label="T7 promoter" /note="promoter for bacteriophage T7 RNA polymerase" primer_bind complement(6245..6261) /label="M13 fwd" /note="common sequencing primer, one of multiple similar variants" rep_origin 6403..6858 /label="f1 ori" /note="f1 bacteriophage origin of replication; arrow indicates direction of (+) strand synthesis" promoter 6884..6988 /label="AmpR promoter" CDS 6989..7846 /label="AmpR" /note="beta-lactamase" rep_origin 8020..8608 /label="ori" /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of replication" primer_bind 8762..8779 /label="L4440" /note="L4440 vector, forward primer" protein_bind 8896..8917 /label="CAP binding site" /note="CAP binding activates transcription in the presence of cAMP." promoter 8932..8962 /label="lac promoter" /note="promoter for the E. coli lac operon" protein_bind 8970..8986 /label="lac operator" /note="The lac repressor binds to the lac operator to inhibit transcription in E. coli. This inhibition can be relieved by adding lactose or isopropyl-beta-D-thiogalactopyranoside (IPTG)." primer_bind 8994..9010 /label="M13 rev" /note="common sequencing primer, one of multiple similar variants" promoter 9031..9049 /label="T3 promoter" /note="promoter for bacteriophage T3 RNA polymerase"