Price Information
| Cat No. | Plasmid Name | Availability | Add to cart |
|---|---|---|---|
| V012133 | pRSI9-U6-(sh)-UbiC-TagRFP-2A-Puro | In stock, instant shipping |
Buy one, get one free! |
Two tubes of lyophilized plasmid will be delivered, each tube is about 5µg.
Basic Vector Information
- Vector Name:
- pRSI9-U6-(sh)-UbiC-TagRFP-2A-Puro
- Antibiotic Resistance:
- Ampicillin
- Length:
- 7500 bp
- Type:
- Mammalian Expression, Lentiviral, RNAi
- Replication origin:
- ori
- Selection Marker:
- Puromycin
- Promoter:
- UbC
- Cloning Method:
- Restriction Enzyme
- 5' Primer:
- FwdU6 (CAAGGCTGTTAGAGAGATAATTGGAA)
- Growth Strain(s):
- Stbl3
- Growth Temperature:
- 37℃
pRSI9-U6-(sh)-UbiC-TagRFP-2A-Puro vector Map
Plasmid Protocol
1. Centrifuge at 5,000×g for 5 min.
2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.
5. Store the plasmid at -20 ℃.
6. The concentration of plasmid re-measurement sometimes differs from the nominal value, which may be due to the position of the lyophilized plasmid in the tube, the efficiency of the re-dissolution, the measurement bias, and adsorption on the wall of the tube, therefore, it is recommended to transform and extract the plasmid before using it
General Plasmid Transform Protocol
1. Take one 100μl of the competent cells and thaw it on ice for 10min, add 2μl of plasmid, then ice bath for 30min, then heat-shock it at 42℃ for 60s, do not stir, and then ice bath for 2min.
2. Add 900μl of LB liquid medium without antibiotics, and incubate at 37℃ for 45min (30℃ for 1-1.5 hours) with 180rpm shaking.
3. Centrifuge at 6000rpm for 5min, leave only 100μl of supernatant to resuspend the bacterial precipitate and spread it onto the target plasmid-resistant LB plate.
4. Invert the plate and incubate at 37℃ for 14h, or at 30℃ for 20h.
5. Pick a single colony into LB liquid medium, add the corresponding antibiotics, incubate at 220rpm for 14h, and extract the plasmid according to the experimental needs and the instructions of the plasmid extraction kit.
pRSI9-U6-(sh)-UbiC-TagRFP-2A-Puro vector Sequence
LOCUS V012133 7500 bp DNA circular SYN 13-MAY-2021
DEFINITION Exported.
ACCESSION V012133
VERSION V012133
KEYWORDS pRSI9-U6-(sh)-UbiC-TagRFP-2A-Puro
SOURCE synthetic DNA construct
ORGANISM synthetic DNA construct
.
REFERENCE 1 (bases 1 to 7500)
AUTHORS Frangou, G
TITLE DECIPHER library reagents
JOURNAL Unpublished
REFERENCE 2 (bases 1 to 7500)
TITLE Direct Submission
REFERENCE 3 (bases 1 to 7500)
AUTHORS .
TITLE Direct Submission
COMMENT SGRef: number: 1; type: "Journal Article"; journalName:
"Unpublished"
SGRef: number: 2; type: "Journal Article"
FEATURES Location/Qualifiers
source 1..7500
/mol_type="other DNA"
/organism="synthetic DNA construct"
promoter 6..232
/label="RSV promoter"
/note="Rous sarcoma virus enhancer/promoter"
LTR 233..413
/label="5' LTR (truncated)"
/note="truncated 5' long terminal repeat (LTR) from HIV-1"
misc_feature 460..585
/label="HIV-1 Psi"
/note="packaging signal of human immunodeficiency virus
type 1"
misc_feature 1078..1311
/label="RRE"
/note="The Rev response element (RRE) of HIV-1 allows for
Rev-dependent mRNA export from the nucleus to the
cytoplasm."
CDS 1496..1540
/label="gp41 peptide"
/note="antigenic peptide corresponding to amino acids 655
to 669 of the HIV envelope protein gp41 (Lutje Hulsik et
al., 2013)"
CDS 1689..1730
/note="Protein Tat from Human immunodeficiency virus type 1
group M subtype B (isolate WMJ22). Accession#: P12509"
/label="Protein Tat"
promoter 1819..2059
/label="U6 promoter"
/note="RNA polymerase III promoter for human U6 snRNA"
misc_feature 2194..2311
/label="cPPT/CTS"
/note="central polypurine tract and central termination
sequence of HIV-1"
promoter 2360..2759
/label="UbC promoter"
/note="human ubiquitin C promoter"
CDS 2772..3482
/label="TagRFP"
/note="monomeric derivative of red fluorescent protein from
Entacmaea quadricolor (Merzlyak et al., 2007)"
CDS 3489..3542
/codon_start=1
/product="2A peptide from Thosea asigna virus capsid
protein"
/label="T2A"
/note="Eukaryotic ribosomes fail to insert a peptide bond
between the Gly and Pro residues, yielding separate
polypeptides."
/translation="EGRGSLLTCGDVEENPGP"
CDS 3549..4145
/label="PuroR"
/note="puromycin N-acetyltransferase"
LTR 4241..4474
/label="3' LTR (Delta-U3)"
/note="self-inactivating 3' long terminal repeat (LTR) from
HIV-1"
polyA_signal 4546..4680
/label="SV40 poly(A) signal"
/note="SV40 polyadenylation signal"
rep_origin 4707..4842
/label="SV40 ori"
/note="SV40 origin of replication"
primer_bind complement(4875..4891)
/label="M13 rev"
/note="common sequencing primer, one of multiple similar
variants"
protein_bind complement(4899..4915)
/label="lac operator"
/note="The lac repressor binds to the lac operator to
inhibit transcription in E. coli. This inhibition can be
relieved by adding lactose or
isopropyl-beta-D-thiogalactopyranoside (IPTG)."
promoter complement(4923..4953)
/label="lac promoter"
/note="promoter for the E. coli lac operon"
protein_bind complement(4968..4989)
/label="CAP binding site"
/note="CAP binding activates transcription in the presence
of cAMP."
primer_bind complement(5106..5123)
/label="L4440"
/note="L4440 vector, forward primer"
rep_origin complement(5277..5865)
/direction=LEFT
/label="ori"
/note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
replication"
CDS complement(6039..6896)
/label="AmpR"
/note="beta-lactamase"
promoter complement(6897..7001)
/label="AmpR promoter"
primer_bind 7069..7087
/label="pBRforEco"
/note="pBR322 vectors, upsteam of EcoRI site, forward
primer"
primer_bind complement(7125..7147)
/label="pGEX 3'"
/note="pGEX vectors, reverse primer"
primer_bind 7247..7266
/label="pRS-marker"
/note="pRS vectors, use to sequence yeast selectable
marker"
primer_bind 7475..7491
/label="M13 fwd"
/note="common sequencing primer, one of multiple similar
variants"