Price Information
| Cat No. | Plasmid Name | Availability | Buy one, get one free! (?) |
|---|---|---|---|
| V012137 | mPiezo1-IRES-eGFP | In stock, 1 week for quality controls |
Two tubes of lyophilized plasmid will be delivered, each tube is about 5µg.
Basic Vector Information
- Vector Name:
- mPiezo1-IRES-eGFP
- Antibiotic Resistance:
- Ampicillin
- Length:
- 14389 bp
- Type:
- Mammalian Expression
- Replication origin:
- ori
- Selection Marker:
- Neomycin (select with G418)
- Copy Number:
- Low Copy
- Cloning Method:
- Restriction Enzyme
- 5' Primer:
- cgcaaatgggcggtaggcgtg
mPiezo1-IRES-eGFP vector Map
Plasmid Protocol
1. Centrifuge at 5,000×g for 5 min.
2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.
5. Store the plasmid at -20 ℃.
6. The concentration of plasmid re-measurement sometimes differs from the nominal value, which may be due to the position of the lyophilized plasmid in the tube, the efficiency of the re-dissolution, the measurement bias, and adsorption on the wall of the tube, therefore, it is recommended to transform and extract the plasmid before using it
General Plasmid Transform Protocol
1. Take one 100μl of the competent cells and thaw it on ice for 10min, add 2μl of plasmid, then ice bath for 30min, then heat-shock it at 42℃ for 60s, do not stir, and then ice bath for 2min.
2. Add 900μl of LB liquid medium without antibiotics, and incubate at 37℃ for 45min (30℃ for 1-1.5 hours) with 180rpm shaking.
3. Centrifuge at 6000rpm for 5min, leave only 100μl of supernatant to resuspend the bacterial precipitate and spread it onto the target plasmid-resistant LB plate.
4. Invert the plate and incubate at 37℃ for 14h, or at 30℃ for 20h.
5. Pick a single colony into LB liquid medium, add the corresponding antibiotics, incubate at 220rpm for 14h, and extract the plasmid according to the experimental needs and the instructions of the plasmid extraction kit.
mPiezo1-IRES-eGFP vector Sequence
LOCUS V012137 14389 bp DNA circular SYN 13-MAY-2021
DEFINITION Exported.
ACCESSION V012137
VERSION V012137
KEYWORDS mPiezo1-IRES-eGFP
SOURCE synthetic DNA construct
ORGANISM synthetic DNA construct
.
REFERENCE 1 (bases 1 to 14389)
AUTHORS Coste B, Mathur J, Schmidt M, Earley TJ, Ranade S, Petrus MJ, Dubin
AE, Patapoutian A
TITLE Piezo1 and Piezo2 are essential components of distinct mechanically
activated cation channels.
JOURNAL Science. 2010 Oct 1;330(6000):55-60. doi: 10.1126/science.1193270.
Epub 2010 Sep 2.
PUBMED 20813920
REFERENCE 2 (bases 1 to 14389)
TITLE Direct Submission
REFERENCE 3 (bases 1 to 14389)
AUTHORS .
TITLE Direct Submission
COMMENT SGRef: number: 1; type: "Journal Article"; doi:
"10.1126/science.1193270"; journalName: "Science"; date: "2010-10-1-
1"; volume: "330"; issue: "6000"; pages: "55-60"
SGRef: number: 2; type: "Journal Article"
FEATURES Location/Qualifiers
source 1..14389
/mol_type="other DNA"
/organism="synthetic DNA construct"
enhancer 124..503
/label="CMV enhancer"
/note="human cytomegalovirus immediate early enhancer"
promoter 504..707
/label="CMV promoter"
/note="human cytomegalovirus (CMV) immediate early
promoter"
promoter 752..770
/label="T7 promoter"
/note="promoter for bacteriophage T7 RNA polymerase"
CDS 829..8469
/gene="Piezo1"
/label="Piezo-type mechanosensitive ion channel component
1"
/note="Piezo-type mechanosensitive ion channel component 1
from Mus musculus. Accession#: E2JF22"
misc_feature 8528..9114
/label="IRES2"
/note="internal ribosome entry site (IRES) of the
encephalomyocarditis virus (EMCV)"
CDS 9115..9831
/label="EGFP"
/note="enhanced GFP"
polyA_signal 9875..9986
/label="bGH poly(A) signal"
/note="bovine growth hormone polyadenylation signal"
rep_origin 10145..10573
/label="f1 ori"
/note="f1 bacteriophage origin of replication; arrow
indicates direction of (+) strand synthesis"
promoter 10587..10916
/label="SV40 promoter"
/note="SV40 enhancer and early promoter"
CDS 10983..11774
/label="NeoR/KanR"
/note="aminoglycoside phosphotransferase"
polyA_signal 11951..12084
/label="SV40 poly(A) signal"
/note="SV40 polyadenylation signal"
primer_bind complement(12121..12137)
/label="M13 rev"
/note="common sequencing primer, one of multiple similar
variants"
primer_bind complement(12121..12137)
/label="M13 Reverse"
/note="In lacZ gene. Also called M13-rev"
primer_bind complement(12134..12156)
/label="M13/pUC Reverse"
/note="In lacZ gene"
protein_bind 12145..12161
/label="lac operator"
/bound_moiety="lac repressor encoded by lacI"
/note="The lac repressor binds to the lac operator to
inhibit transcription in E. coli. This inhibition can be
relieved by adding lactose or
isopropyl-beta-D-thiogalactopyranoside (IPTG)."
promoter complement(12169..12199)
/label="lac promoter"
/note="promoter for the E. coli lac operon"
protein_bind complement(12214..12235)
/label="CAP binding site"
/note="CAP binding activates transcription in the presence
of cAMP."
primer_bind complement(12352..12369)
/label="L4440"
/note="L4440 vector, forward primer"
rep_origin complement(12523..13111)
/direction=LEFT
/label="ori"
/note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
replication"
CDS complement(13285..14142)
/label="AmpR"
/note="beta-lactamase"
promoter complement(14143..14247)
/label="AmpR promoter"
primer_bind complement(14322..14341)
/label="pRS-marker"
/note="pRS vectors, use to sequence yeast selectable
marker"