mPiezo1-IRES-eGFP vector (V012137)

Price Information

Cat No. Plasmid Name Availability Buy one, get one free! (?)
V012137 mPiezo1-IRES-eGFP In stock, 1 week for quality controls

Two tubes of lyophilized plasmid will be delivered, each tube is about 5µg.

Basic Vector Information

Vector Name:
mPiezo1-IRES-eGFP
Antibiotic Resistance:
Ampicillin
Length:
14389 bp
Type:
Mammalian Expression
Replication origin:
ori
Selection Marker:
Neomycin (select with G418)
Copy Number:
Low Copy
Cloning Method:
Restriction Enzyme
5' Primer:
cgcaaatgggcggtaggcgtg

mPiezo1-IRES-eGFP vector Map

mPiezo1-IRES-eGFP14389 bp7001400210028003500420049005600630070007700840091009800105001120011900126001330014000CMV enhancerCMV promoterT7 promoterPiezo-type mechanosensitive ion channel component1IRES2EGFPbGH poly(A) signalf1 oriSV40 promoterNeoR/KanRSV40 poly(A) signalIn lacZ genelac promoterCAP binding siteL4440oriAmpRAmpR promoterpRS-marker

Plasmid Protocol

1. Centrifuge at 5,000×g for 5 min.

2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.

3. Close the tube and incubate for 10 minutes at room temperature.

4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.

5. Store the plasmid at -20 ℃.

6. The concentration of plasmid re-measurement sometimes differs from the nominal value, which may be due to the position of the lyophilized plasmid in the tube, the efficiency of the re-dissolution, the measurement bias, and adsorption on the wall of the tube, therefore, it is recommended to transform and extract the plasmid before using it

General Plasmid Transform Protocol

1. Take one 100μl of the competent cells and thaw it on ice for 10min, add 2μl of plasmid, then ice bath for 30min, then heat-shock it at 42℃ for 60s, do not stir, and then ice bath for 2min.

2. Add 900μl of LB liquid medium without antibiotics, and incubate at 37℃ for 45min (30℃ for 1-1.5 hours) with 180rpm shaking.

3. Centrifuge at 6000rpm for 5min, leave only 100μl of supernatant to resuspend the bacterial precipitate and spread it onto the target plasmid-resistant LB plate.

4. Invert the plate and incubate at 37℃ for 14h, or at 30℃ for 20h.

5. Pick a single colony into LB liquid medium, add the corresponding antibiotics, incubate at 220rpm for 14h, and extract the plasmid according to the experimental needs and the instructions of the plasmid extraction kit.

mPiezo1-IRES-eGFP vector Sequence

LOCUS       V012137                14389 bp    DNA     circular SYN 13-MAY-2021
DEFINITION  Exported.
ACCESSION   V012137
VERSION     V012137
KEYWORDS    mPiezo1-IRES-eGFP
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
            .
REFERENCE   1  (bases 1 to 14389)
  AUTHORS   Coste B, Mathur J, Schmidt M, Earley TJ, Ranade S, Petrus MJ, Dubin
            AE, Patapoutian A
  TITLE     Piezo1 and Piezo2 are essential components of distinct mechanically
            activated cation channels.
  JOURNAL   Science. 2010 Oct 1;330(6000):55-60. doi: 10.1126/science.1193270.
            Epub 2010 Sep 2.
   PUBMED   20813920
REFERENCE   2  (bases 1 to 14389)
  TITLE     Direct Submission
REFERENCE   3  (bases 1 to 14389)
  AUTHORS   .
  TITLE     Direct Submission
COMMENT     SGRef: number: 1; type: "Journal Article"; doi:
            "10.1126/science.1193270"; journalName: "Science"; date: "2010-10-1-
            1"; volume: "330"; issue: "6000"; pages: "55-60"
            SGRef: number: 2; type: "Journal Article"
FEATURES             Location/Qualifiers
     source          1..14389
                     /mol_type="other DNA"
                     /organism="synthetic DNA construct"
     enhancer        124..503
                     /label="CMV enhancer"
                     /note="human cytomegalovirus immediate early enhancer"
     promoter        504..707
                     /label="CMV promoter"
                     /note="human cytomegalovirus (CMV) immediate early
                     promoter"
     promoter        752..770
                     /label="T7 promoter"
                     /note="promoter for bacteriophage T7 RNA polymerase"
     CDS             829..8469
                     /gene="Piezo1"
                     /label="Piezo-type mechanosensitive ion channel component
                     1"
                     /note="Piezo-type mechanosensitive ion channel component 1
                     from Mus musculus. Accession#: E2JF22"
     misc_feature    8528..9114
                     /label="IRES2"
                     /note="internal ribosome entry site (IRES) of the
                     encephalomyocarditis virus (EMCV)"
     CDS             9115..9831
                     /label="EGFP"
                     /note="enhanced GFP"
     polyA_signal    9875..9986
                     /label="bGH poly(A) signal"
                     /note="bovine growth hormone polyadenylation signal"
     rep_origin      10145..10573
                     /label="f1 ori"
                     /note="f1 bacteriophage origin of replication; arrow
                     indicates direction of (+) strand synthesis"
     promoter        10587..10916
                     /label="SV40 promoter"
                     /note="SV40 enhancer and early promoter"
     CDS             10983..11774
                     /label="NeoR/KanR"
                     /note="aminoglycoside phosphotransferase"
     polyA_signal    11951..12084
                     /label="SV40 poly(A) signal"
                     /note="SV40 polyadenylation signal"
     primer_bind     complement(12121..12137)
                     /label="M13 rev"
                     /note="common sequencing primer, one of multiple similar
                     variants"
     primer_bind     complement(12121..12137)
                     /label="M13 Reverse"
                     /note="In lacZ gene. Also called M13-rev"
     primer_bind     complement(12134..12156)
                     /label="M13/pUC Reverse"
                     /note="In lacZ gene"
     protein_bind    12145..12161
                     /label="lac operator"
                     /bound_moiety="lac repressor encoded by lacI"
                     /note="The lac repressor binds to the lac operator to
                     inhibit transcription in E. coli. This inhibition can be
                     relieved by adding lactose or
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     promoter        complement(12169..12199)
                     /label="lac promoter"
                     /note="promoter for the E. coli lac operon"
     protein_bind    complement(12214..12235)
                     /label="CAP binding site"
                     /note="CAP binding activates transcription in the presence
                     of cAMP."
     primer_bind     complement(12352..12369)
                     /label="L4440"
                     /note="L4440 vector, forward primer"
     rep_origin      complement(12523..13111)
                     /direction=LEFT
                     /label="ori"
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
                     replication"
     CDS             complement(13285..14142)
                     /label="AmpR"
                     /note="beta-lactamase"
     promoter        complement(14143..14247)
                     /label="AmpR promoter"
     primer_bind     complement(14322..14341)
                     /label="pRS-marker"
                     /note="pRS vectors, use to sequence yeast selectable
                     marker"