pVITRO-HPV11 L1L2 vector (V012138) Gene synthesis in pVITRO-HPV11 L1L2 backbone

Price Information

Cat No. Plasmid Name Availability Buy one, get one free! (?)
V012138 pVITRO-HPV11 L1L2 In stock, instant shipping

Two tubes of lyophilized plasmid will be delivered, each tube is about 5µg.

Basic Vector Information

Expresses HPV11 L1 and L2 in mammalian cells

Vector Name:
pVITRO-HPV11 L1L2
Antibiotic Resistance:
Kanamycin
Length:
9175 bp
Type:
Mammalian Expression
Replication origin:
ori
Source/Author:
Richard Roden
Selection Marker:
Neomycin (select with G418)
Copy Number:
High Copy
Promoter:
mEF-1α
Cloning Method:
Restriction Enzyme
5' Primer:
GCCTCTTAGCGGTTCAAAGG
3' Primer:
CAAAGGTATTTTCTAAACCCGTTTC
Growth Strain(s):
stbl3
Growth Temperature:
37℃

pVITRO-HPV11 L1L2 vector Map

pVITRO-HPV11 L1L29175 bp40080012001600200024002800320036004000440048005200560060006400680072007600800084008800SV40 enhancermEF-1-alpha promoterSV40 poly(A) signaloriCMV enhancerrEF-1-alpha promoterMinor capsid protein L2FMDV IRESEM7 promoterNeoR/KanREF-1-alpha poly(A) signal

Plasmid Protocol

1. Centrifuge at 5,000×g for 5 min.

2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.

3. Close the tube and incubate for 10 minutes at room temperature.

4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.

5. Store the plasmid at -20 ℃.

6. The concentration of plasmid re-measurement sometimes differs from the nominal value, which may be due to the position of the lyophilized plasmid in the tube, the efficiency of the re-dissolution, the measurement bias, and adsorption on the wall of the tube, therefore, it is recommended to transform and extract the plasmid before using it

General Plasmid Transform Protocol

1. Take one 100μl of the competent cells and thaw it on ice for 10min, add 2μl of plasmid, then ice bath for 30min, then heat-shock it at 42℃ for 60s, do not stir, and then ice bath for 2min.

2. Add 900μl of LB liquid medium without antibiotics, and incubate at 37℃ for 45min (30℃ for 1-1.5 hours) with 180rpm shaking.

3. Centrifuge at 6000rpm for 5min, leave only 100μl of supernatant to resuspend the bacterial precipitate and spread it onto the target plasmid-resistant LB plate.

4. Invert the plate and incubate at 37℃ for 14h, or at 30℃ for 20h.

5. Pick a single colony into LB liquid medium, add the corresponding antibiotics, incubate at 220rpm for 14h, and extract the plasmid according to the experimental needs and the instructions of the plasmid extraction kit.

References

  • Impact of inhibitors and L2 antibodies upon the infectivity of diverse alpha and beta human papillomavirus types. Kwak K, Jiang R, Wang JW, Jagu S, Kirnbauer R, Roden RB. PLoS One. 2014 May 9;9(5):e97232. doi: 10.1371/journal.pone.0097232. eCollection 2014. 10.1371/journal.pone.0097232 PubMed 24816794

pVITRO-HPV11 L1L2 vector Sequence

LOCUS       V012138                 9175 bp    DNA     circular SYN 13-MAY-2021
DEFINITION  Exported.
ACCESSION   V012138
VERSION     V012138
KEYWORDS    pVITRO-HPV11 L1L2
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
            .
REFERENCE   1  (bases 1 to 9175)
  AUTHORS   Kwak K, Jiang R, Wang JW, Jagu S, Kirnbauer R, Roden RB
  TITLE     Impact of inhibitors and L2 antibodies upon the infectivity of
            diverse alpha and beta human papillomavirus types.
  JOURNAL   PLoS One. 2014 May 9;9(5):e97232. doi: 10.1371/journal.pone.0097232.
            eCollection 2014.
   PUBMED   24816794
REFERENCE   2  (bases 1 to 9175)
  TITLE     Direct Submission
REFERENCE   3  (bases 1 to 9175)
  AUTHORS   .
  TITLE     Direct Submission
COMMENT     SGRef: number: 1; type: "Journal Article"; journalName: "PLoS One.";
            date: "2014-05-9"; pages: "
            10.1371/journal.pone.0097232. eCollection 2014"
            SGRef: number: 2; type: "Journal Article"
FEATURES             Location/Qualifiers
     source          1..9175
                     /mol_type="other DNA"
                     /organism="synthetic DNA construct"
     enhancer        51..242
                     /label="SV40 enhancer"
                     /note="enhancer for the SV40 early promoter (Herr, 1993)"
     promoter        256..1562
                     /label="mEF-1-alpha promoter"
                     /note="strong constitutive promoter for mouse elongation
                     factor EF-1-alpha"
     polyA_signal    complement(3116..3237)
                     /label="SV40 poly(A) signal"
                     /note="SV40 polyadenylation signal"
     rep_origin      3425..4013
                     /label="ori"
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
                     replication"
     enhancer        4093..4396
                     /label="CMV enhancer"
                     /note="human cytomegalovirus immediate early enhancer"
     promoter        4511..5816
                     /label="rEF-1-alpha promoter"
                     /note="strong constitutive promoter for rat elongation
                     factor EF-1-alpha"
     CDS             5841..7205
                     /gene="L2"
                     /label="Minor capsid protein L2"
                     /note="Minor capsid protein L2 from Human papillomavirus
                     11. Accession#: P04013"
     misc_feature    7218..7662
                     /label="FMDV IRES"
                     /note="internal ribosome entry site (IRES) of the
                     foot-and-mouth disease virus"
     promoter        7694..7741
                     /label="EM7 promoter"
                     /note="synthetic bacterial promoter"
     CDS             7761..8552
                     /label="NeoR/KanR"
                     /note="aminoglycoside phosphotransferase"
     polyA_signal    8602..9174
                     /label="EF-1-alpha poly(A) signal"
                     /note="human EF-1-alpha polyadenylation signal"