Price Information
| Cat No. | Plasmid Name | Availability | Add to cart |
|---|---|---|---|
| V012184 | pSico PGK puro | In stock, 1 week for quality controls |
Buy one, get one free! |
Two tubes of lyophilized plasmid will be delivered, each tube is about 5µg.
Basic Vector Information
- Vector Name:
- pSico PGK puro
- Antibiotic Resistance:
- Ampicillin
- Length:
- 7703 bp
- Type:
- Lentiviral vectors
- Replication origin:
- ori
- Copy Number:
- High copy number
- Promoter:
- mPGK
- Cloning Method:
- Enzyme digestion and ligation
- 5' Primer:
- CMV-F：CGCAAATGGGCGGTAGGCGTG
pSico PGK puro vector Map
Plasmid Protocol
1. Centrifuge at 5,000×g for 5 min.
2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.
5. Store the plasmid at -20 ℃.
6. The concentration of plasmid re-measurement sometimes differs from the nominal value, which may be due to the position of the lyophilized plasmid in the tube, the efficiency of the re-dissolution, the measurement bias, and adsorption on the wall of the tube, therefore, it is recommended to transform and extract the plasmid before using it
General Plasmid Transform Protocol
1. Take one 100μl of the competent cells and thaw it on ice for 10min, add 2μl of plasmid, then ice bath for 30min, then heat-shock it at 42℃ for 60s, do not stir, and then ice bath for 2min.
2. Add 900μl of LB liquid medium without antibiotics, and incubate at 37℃ for 45min (30℃ for 1-1.5 hours) with 180rpm shaking.
3. Centrifuge at 6000rpm for 5min, leave only 100μl of supernatant to resuspend the bacterial precipitate and spread it onto the target plasmid-resistant LB plate.
4. Invert the plate and incubate at 37℃ for 14h, or at 30℃ for 20h.
5. Pick a single colony into LB liquid medium, add the corresponding antibiotics, incubate at 220rpm for 14h, and extract the plasmid according to the experimental needs and the instructions of the plasmid extraction kit.
pSico PGK puro vector Sequence
LOCUS V012184 7703 bp DNA circular SYN 13-JAN-2022
DEFINITION Exported.
ACCESSION V012184
VERSION V012184
KEYWORDS .
SOURCE synthetic DNA construct
ORGANISM synthetic DNA construct
.
REFERENCE 1 (bases 1 to 7703)
TITLE Direct Submission
REFERENCE 2 (bases 1 to 7703)
AUTHORS .
TITLE Direct Submission
COMMENT SGRef: number: 1; type: "Journal Article"
FEATURES Location/Qualifiers
source 1..7703
/mol_type="other DNA"
/organism="synthetic DNA construct"
enhancer 238..617
/label="CMV enhancer"
/note="human cytomegalovirus immediate early enhancer"
promoter 618..820
/label="CMV promoter"
/note="human cytomegalovirus (CMV) immediate early
promoter"
LTR 835..1015
/label="5' LTR (truncated)"
/note="5' LTR (truncated)"
/note="truncated 5' long terminal repeat (LTR) from HIV-1"
misc_feature 1062..1187
/label="HIV-1 Psi"
/note="packaging signal of human immunodeficiency virus
type 1"
misc_feature 1686..1919
/label="RRE"
/note="The Rev response element (RRE) of HIV-1 allows for
Rev-dependent mRNA export from the nucleus to the
cytoplasm."
CDS 2104..2148
/label="gp41 peptide"
/note="antigenic peptide corresponding to amino acids 655
to 669 of the HIV envelope protein gp41 (Lutje Hulsik et
al., 2013)"
CDS 2297..2338
/note="Protein Tat from Human immunodeficiency virus type 1
group M subtype B (isolate WMJ22). Accession#: P12509"
/label="Protein Tat"
misc_feature 2446..2563
/label="cPPT/CTS"
/note="central polypurine tract and central termination
sequence of HIV-1"
protein_bind 2891..2924
/label="Cre recombinase binding site"
/bound_moiety="Cre recombinase"
/note="loxP511"
/note="Cre-mediated recombination occurs in the 8-bp core
sequence (GTATACAT). loxP511 sites are compatible with each
other, but incompatible with wild-type loxP sites."
promoter 2966..3465
/label="PGK promoter"
/note="mouse phosphoglycerate kinase 1 promoter"
CDS 3509..4105
/label="PuroR"
/note="puromycin N-acetyltransferase"
protein_bind complement(4441..4474)
/label="loxP511"
/note="Cre-mediated recombination occurs in the 8-bp core
sequence (ATGTATAC) (Shaw et al., 2021). loxP511 sites are
compatible with each other, but incompatible with wild-type
loxP sites."
primer_bind 4501..4517
/label="KS primer"
/note="common sequencing primer, one of multiple similar
variants"
misc_feature 4592..5180
/label="WPRE"
/note="woodchuck hepatitis virus posttranscriptional
regulatory element"
primer_bind complement(5183..5199)
/label="KS primer"
/note="common sequencing primer, one of multiple similar
variants"
LTR 5709..5889
/label="5' LTR (truncated)"
/note="truncated 5' long terminal repeat (LTR) from HIV-1"
rep_origin complement(5951..6539)
/direction=LEFT
/label="ori"
/note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
replication"
CDS complement(6713..7570)
/label="AmpR"
/note="beta-lactamase"
promoter complement(7571..7675)
/label="AmpR promoter"