pShuttle-CMV vector (V012203)

Price Information

Cat No.	Plasmid Name	Availability	Add to cart
V012203	pShuttle-CMV	In stock, 1 week for quality controls	Buy one, get one free!

Two tubes of lyophilized plasmid will be delivered, each tube is about 5µg.

Basic Vector Information

The vector pShuttle-CMV contains a multiple cloning site sandwiched between the CMV promoter and the SV40 polyadenylation signal and is suitable for insertion of a large cDNA (up to 6.6 kb). pShuttle contains only a multiple cloning site. This allows for the insertion of an entire expression cassette, including specialized promoters and termination signals (up to 7.5 kb). The regions indicated as arms are the stretches of sequence homology with pAdEasy-1 where the homologous recombination occurs. The R-ITR and L-ITR regions are short inverted terminal repeats (Left and Right) which have a role in replication of the viral DNA.

Vector Name:: pShuttle-CMV

Antibiotic Resistance:: Kanamycin

Length:: 7469 bp

Type:: Adenovirus Systems

Replication origin:: ori

Copy Number:: Low copy number

Promoter:: CMV

Cloning Method:: Enzyme digestion and ligation

5' Primer:: pShuttle-CMV-F: GGTCTATATAAGCAGAGCTG

3' Primer:: pShuttle-CMV-R: GTGGTATGGCTGATTATGATCAG

pShuttle-CMV vector Vector Map

View Map in NovoBuilder

Plasmid Protocol

1. Centrifuge at 5,000×g for 5 min.

2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.

3. Close the tube and incubate for 10 minutes at room temperature.

4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.

5. Store the plasmid at -20 ℃.

6. The concentration of plasmid re-measurement sometimes differs from the nominal value, which may be due to the position of the lyophilized plasmid in the tube, the efficiency of the re-dissolution, the measurement bias, and adsorption on the wall of the tube, therefore, it is recommended to transform and extract the plasmid before using it

General Plasmid Transform Protocol

1. Take one 100μl of the competent cells and thaw it on ice for 10min, add 2μl of plasmid, then ice bath for 30min, then heat-shock it at 42℃ for 60s, do not stir, and then ice bath for 2min.

2. Add 900μl of LB liquid medium without antibiotics, and incubate at 37℃ for 45min (30℃ for 1-1.5 hours) with 180rpm shaking.

3. Centrifuge at 6000rpm for 5min, leave only 100μl of supernatant to resuspend the bacterial precipitate and spread it onto the target plasmid-resistant LB plate.

4. Invert the plate and incubate at 37℃ for 14h, or at 30℃ for 20h.

5. Pick a single colony into LB liquid medium, add the corresponding antibiotics, incubate at 220rpm for 14h, and extract the plasmid according to the experimental needs and the instructions of the plasmid extraction kit.

pShuttle-CMV vector Sequence

Copy Sequence

Download GeneBank File(.gb)

LOCUS       V012203                 7469 bp    DNA     circular SYN 13-JAN-2022
DEFINITION  Exported.
ACCESSION   V012203
VERSION     V012203
KEYWORDS    .
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
            .
REFERENCE   1  (bases 1 to 7469)
  TITLE     Direct Submission
REFERENCE   2  (bases 1 to 7469)
  AUTHORS   .
  TITLE     Direct Submission
COMMENT     SGRef: number: 1; type: "Journal Article"
FEATURES             Location/Qualifiers
     source          1..7469
                     /mol_type="other DNA"
                     /organism="synthetic DNA construct"
     repeat_region   1..103
                     /label="ITR"
                     /note="inverted terminal repeat of human adenovirus
                     serotype 5"
     misc_signal     191..341
                     /label="Ad5 Psi"
                     /note="packaging signal for adenovirus serotype 5"
     enhancer        399..702
                     /label="CMV enhancer"
                     /note="human cytomegalovirus immediate early enhancer"
     promoter        703..906
                     /label="CMV promoter"
                     /note="human cytomegalovirus (CMV) immediate early
                     promoter"
     polyA_signal    1117..1238
                     /label="SV40 poly(A) signal"
                     /note="SV40 polyadenylation signal"
     CDS             1332..1751
                     /gene="IX"
                     /label="Hexon-interlacing protein"
                     /note="Hexon-interlacing protein from Human adenovirus C
                     serotype 5. Accession#: P03281"
     CDS             complement(1817..3151)
                     /gene="IVa2"
                     /label="Packaging protein 1"
                     /note="Packaging protein 1 from Human adenovirus C serotype
                     5. Accession#: P03271"
     CDS             complement(3736..4119)
                     /note="Early 4 ORF1 protein from Human adenovirus C
                     serotype 2. Accession#: P03242"
                     /label="Early 4 ORF1 protein"
     repeat_region   4429..4531
                     /label="ITR"
                     /note="inverted terminal repeat of human adenovirus
                     serotype 5"
     rep_origin      complement(4791..5379)
                     /direction=LEFT
                     /label="ori"
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
                     replication"
     CDS             6211..7002
                     /label="NeoR/KanR"
                     /note="aminoglycoside phosphotransferase"
     rep_origin      complement(7053..7432)
                     /direction=LEFT
                     /label="M13 ori"
                     /note="M13 bacteriophage origin of replication; arrow
                     indicates direction of (+) strand synthesis"