Cart 2

pCHAC-mt-mKeima vector (V012220)

Price Information

Cat No. Plasmid Name Availability Add to cart
V012220 pCHAC-mt-mKeima In stock, 1 week for quality controls

Buy one, get one free!

Two tubes of lyophilized plasmid will be delivered, each tube is about 5µg.

Basic Vector Information

Vector Name:
pCHAC-mt-mKeima
Antibiotic Resistance:
Ampicillin
Length:
6455 bp
Type:
Retroviral
Replication origin:
ori
Copy Number:
High Copy
Cloning Method:
Restriction Enzyme
5' Primer:
TGACCTGGGAAGCCTTGGCT
3' Primer:
TTGCCAAAAGACGGCAATAT

pCHAC-mt-mKeima vector Map

Copy Sequence View Map
pCHAC-mt-mKeima6455 bp300600900120015001800210024002700300033003600390042004500480051005400570060006300long terminal repeat from Moloney murine leukemiavirusMMLV Psigag (truncated)pol regionCOX8 presequenceCOX8 presequencemKeima-RedIRES2LTRL4440oriAmpR

Plasmid Protocol

1. Centrifuge at 5,000×g for 5 min.

2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.

3. Close the tube and incubate for 10 minutes at room temperature.

4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.

5. Store the plasmid at -20 ℃.

6. The concentration of plasmid re-measurement sometimes differs from the nominal value, which may be due to the position of the lyophilized plasmid in the tube, the efficiency of the re-dissolution, the measurement bias, and adsorption on the wall of the tube, therefore, it is recommended to transform and extract the plasmid before using it

General Plasmid Transform Protocol

1. Take one 100μl of the competent cells and thaw it on ice for 10min, add 2μl of plasmid, then ice bath for 30min, then heat-shock it at 42℃ for 60s, do not stir, and then ice bath for 2min.

2. Add 900μl of LB liquid medium without antibiotics, and incubate at 37℃ for 45min (30℃ for 1-1.5 hours) with 180rpm shaking.

3. Centrifuge at 6000rpm for 5min, leave only 100μl of supernatant to resuspend the bacterial precipitate and spread it onto the target plasmid-resistant LB plate.

4. Invert the plate and incubate at 37℃ for 14h, or at 30℃ for 20h.

5. Pick a single colony into LB liquid medium, add the corresponding antibiotics, incubate at 220rpm for 14h, and extract the plasmid according to the experimental needs and the instructions of the plasmid extraction kit.

pCHAC-mt-mKeima vector Sequence

LOCUS       pCHAC-mt-mKeima.        6455 bp DNA     circular SYN 13-MAY-2021
DEFINITION  retrovirus construct for stable expressing mt-mKeima.
ACCESSION   .
VERSION     .
KEYWORDS    pCHAC-mt-mKeima
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 6455)
  AUTHORS   Lazarou M, Sliter DA, Kane LA, Sarraf SA, Wang C, Burman JL, Sideris
            DP, Fogel AI, Youle RJ
  TITLE     The ubiquitin kinase PINK1 recruits autophagy receptors to induce 
            mitophagy.
  JOURNAL   Nature. 2015 Aug 20;524(7565):309-14. doi: 10.1038/nature14893. Epub
            2015 Aug 12.
  PUBMED    26266977
REFERENCE   2  (bases 1 to 6455)
  TITLE     Direct Submission
REFERENCE   3  (bases 1 to 6455)
  AUTHORS   .
  TITLE     Direct Submission
COMMENT     SGRef: number: 1; type: "Journal Article"; doi: 
            "10.1038/nature14893"; journalName: "Nature"; date: "2015-08-20-
            20"; volume: "524"; issue: "7565"; pages: "309-14"
COMMENT     SGRef: number: 2; type: "Journal Article"
FEATURES             Location/Qualifiers
     source          1..6455
                     /mol_type="other DNA"
                     /organism="synthetic DNA construct"
     LTR             514..983
                     /note="long terminal repeat from Moloney murine leukemia
                     virus"
     misc_feature    1048..1405
                     /label=MMLV Psi
                     /note="packaging signal of Moloney murine leukemia virus
                     (MMLV)"
     CDS             1470..1886
                     /label=gag (truncated)
                     /note="truncated Moloney murine leukemia virus (MMLV) gag
                     gene lacking the start codon"
     misc_feature    1896..2270
                     /label=pol region
                     /note="Moloney murine leukemia virus (MMLV) pol region 
                     containing the splice acceptor site"
     CDS             2303..2377
                     /codon_start=1
                     /product="mitochondrial presequence of human cytochrome c
                     oxidase subunit VIII (Rizutto et al., 1989)"
                     /label=COX8 presequence
                     /translation="MSVLTPLLLRGLTGSARRLPVPRAK"
     CDS             2411..2485
                     /codon_start=1
                     /product="mitochondrial presequence of human cytochrome c
                     oxidase subunit VIII (Rizutto et al., 1989)"
                     /label=COX8 presequence
                     /translation="MSVLTPLLLRGLTGSARRLPVPRAK"
     CDS             2528..3193
                     /label=mKeima-Red
                     /note="monomeric Keima-Red fluorescent protein, also known
                     as mKeima"
     misc_feature    3202..3778
                     /label=IRES2
                     /note="internal ribosome entry site (IRES) of the 
                     encephalomyocarditis virus (EMCV)"
     LTR             3898..4489
                     /label=LTR
                     /note="long terminal repeat from Moloney murine leukemia
                     virus"
     primer_bind     complement(4619..4636)
                     /label=L4440
                     /note="L4440 vector, forward primer"
     rep_origin      complement(4790..5378)
                     /direction=LEFT
                     /label=ori
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of 
                     replication"
     CDS             complement(5545..6402)
                     /label=AmpR
                     /note="beta-lactamase"