pENTR4-FLAG vector (V010494)

Price Information

Cat No. Plasmid Name Availability Add to cart
V010494 pENTR4-FLAG In stock, 1 week for quality controls

Buy one, get one free!

Two tubes of lyophilized plasmid will be delivered, each tube is about 5µg.

Basic Vector Information

Vector Name:
pENTR4-FLAG
Antibiotic Resistance:
Kanamycin
Length:
3401 bp
Type:
Gateway vectors
Replication origin:
ori
Copy Number:
Low copy number
Cloning Method:
Enzyme digestion and ligation
5' Primer:
ENTR-F:  CTACAAACTCTTCCTGTTAGTTAG
3' Primer:
ENTR-R:  ATGGCTCATAACACCCCTTG
Fusion Tag:
N-FLAG

pENTR4-FLAG vector Map

pENTR4-FLAG3401 bp6001200180024003000rrnB T1 terminatorrrnB T2 terminatorattL1FLAGattL2KanRorirrnB T1 terminatorrrnB T2 terminatorattL1FLAGattL2

Plasmid Protocol

1. Centrifuge at 5,000×g for 5 min.

2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.

3. Close the tube and incubate for 10 minutes at room temperature.

4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.

5. Store the plasmid at -20 ℃.

6. The concentration of plasmid re-measurement sometimes differs from the nominal value, which may be due to the position of the lyophilized plasmid in the tube, the efficiency of the re-dissolution, the measurement bias, and adsorption on the wall of the tube, therefore, it is recommended to transform and extract the plasmid before using it

General Plasmid Transform Protocol

1. Take one 100μl of the competent cells and thaw it on ice for 10min, add 2μl of plasmid, then ice bath for 30min, then heat-shock it at 42℃ for 60s, do not stir, and then ice bath for 2min.

2. Add 900μl of LB liquid medium without antibiotics, and incubate at 37℃ for 45min (30℃ for 1-1.5 hours) with 180rpm shaking.

3. Centrifuge at 6000rpm for 5min, leave only 100μl of supernatant to resuspend the bacterial precipitate and spread it onto the target plasmid-resistant LB plate.

4. Invert the plate and incubate at 37℃ for 14h, or at 30℃ for 20h.

5. Pick a single colony into LB liquid medium, add the corresponding antibiotics, incubate at 220rpm for 14h, and extract the plasmid according to the experimental needs and the instructions of the plasmid extraction kit.

pENTR4-FLAG vector Sequence

LOCUS       40924_17532        3401 bp DNA     circular SYN 13-JAN-2022
DEFINITION  synthetic circular DNA.
ACCESSION   .
VERSION     .
KEYWORDS    .
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 3401)
  TITLE     Direct Submission
REFERENCE   2  (bases 1 to 3401)
  AUTHORS   .
  TITLE     Direct Submission
COMMENT     SGRef: number: 1; type: "Journal Article"
FEATURES             Location/Qualifiers
     source          1..3401
                     /mol_type="other DNA"
                     /organism="synthetic DNA construct"
     terminator      103..189
                     /label=rrnB T1 terminator
                     /note="transcription terminator T1 from the E. coli rrnB
                     gene"
     terminator      281..308
                     /label=rrnB T2 terminator
                     /note="transcription terminator T2 from the E. coli rrnB
                     gene"
     protein_bind    358..457
                     /label=attL1
                     /note="recombination site for the Gateway(R) LR reaction"
     CDS             466..489
                     /label=FLAG
                     /note="FLAG(R) epitope tag, followed by an enterokinase
                     cleavage site"
     protein_bind    complement(562..661)
                     /gene="mutant version of attL"
                     /label=LR Clonase(TM) binding site
                     /bound_moiety="LR Clonase(TM)"
                     /note="attL2"
                     /note="recombination site for the Gateway(R) LR reaction"
     CDS             784..1590
                     /label=KanR
                     /note="aminoglycoside phosphotransferase"
     rep_origin      1683..2271
                     /direction=RIGHT
                     /label=ori
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of 
                     replication"
     terminator      2562..2605
                     /label=rrnB T1 terminator
                     /note="transcription terminator T1 from the E. coli rrnB
                     gene"
     terminator      2737..2764
                     /note="rrnB T2 terminator"
                     /note="transcription terminator T2 from the E. coli rrnB
                     gene"
     protein_bind    2828..2927
                     /gene="mutant version of attL"
                     /label=LR Clonase(TM) binding site
                     /bound_moiety="LR Clonase(TM)"
                     /note="attL1"
                     /note="recombination site for the Gateway(R) LR reaction"
     CDS             2936..2959
                     /label=FLAG
                     /note="FLAG(R) epitope tag, followed by an enterokinase
                     cleavage site"
     protein_bind    complement(3032..3131)
                     /label=attL2
                     /note="recombination site for the Gateway(R) LR reaction"