Basic Vector Information
- Vector Name:
- pENTR4-FLAG
- Antibiotic Resistance:
- Kanamycin
- Length:
- 3401 bp
- Type:
- Gateway vectors
- Replication origin:
- ori
- Copy Number:
- Low copy number
- Cloning Method:
- Enzyme digestion and ligation
- 5' Primer:
- ENTR-F: CTACAAACTCTTCCTGTTAGTTAG
- 3' Primer:
- ENTR-R: ATGGCTCATAACACCCCTTG
- Fusion Tag:
- N-FLAG
pENTR4-FLAG vector Vector Map
Plasmid Resuspension Protocol:
1. Centrifuge at 5,000×g for 5 min.
2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.
5.Store the plasmid at -20 ℃.
pENTR4-FLAG vector Sequence
LOCUS 40924_17532 3401 bp DNA circular SYN 13-JAN-2022 DEFINITION synthetic circular DNA. ACCESSION . VERSION . KEYWORDS . SOURCE synthetic DNA construct ORGANISM synthetic DNA construct REFERENCE 1 (bases 1 to 3401) TITLE Direct Submission REFERENCE 2 (bases 1 to 3401) AUTHORS . TITLE Direct Submission COMMENT SGRef: number: 1; type: "Journal Article" FEATURES Location/Qualifiers source 1..3401 /mol_type="other DNA" /organism="synthetic DNA construct" terminator 103..189 /label=rrnB T1 terminator /note="transcription terminator T1 from the E. coli rrnB gene" terminator 281..308 /label=rrnB T2 terminator /note="transcription terminator T2 from the E. coli rrnB gene" protein_bind 358..457 /label=attL1 /note="recombination site for the Gateway(R) LR reaction" CDS 466..489 /label=FLAG /note="FLAG(R) epitope tag, followed by an enterokinase cleavage site" protein_bind complement(562..661) /gene="mutant version of attL" /label=LR Clonase(TM) binding site /bound_moiety="LR Clonase(TM)" /note="attL2" /note="recombination site for the Gateway(R) LR reaction" CDS 784..1590 /label=KanR /note="aminoglycoside phosphotransferase" rep_origin 1683..2271 /direction=RIGHT /label=ori /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of replication" terminator 2562..2605 /label=rrnB T1 terminator /note="transcription terminator T1 from the E. coli rrnB gene" terminator 2737..2764 /note="rrnB T2 terminator" /note="transcription terminator T2 from the E. coli rrnB gene" protein_bind 2828..2927 /gene="mutant version of attL" /label=LR Clonase(TM) binding site /bound_moiety="LR Clonase(TM)" /note="attL1" /note="recombination site for the Gateway(R) LR reaction" CDS 2936..2959 /label=FLAG /note="FLAG(R) epitope tag, followed by an enterokinase cleavage site" protein_bind complement(3032..3131) /label=attL2 /note="recombination site for the Gateway(R) LR reaction"
This page is informational only.