AAVS1-Blasticidin-CAG-Flpe-ERT2 vector (V010517)

Price Information

Cat No. Plasmid Name Availability Add to cart
V010517 AAVS1-Blasticidin-CAG-Flpe-ERT2 In stock, 1 week for quality controls

Buy one, get one free!

Two tubes of lyophilized plasmid will be delivered, each tube is about 5µg.

Basic Vector Information

Vector Name:
AAVS1-Blasticidin-CAG-Flpe-ERT2
Antibiotic Resistance:
Ampicillin
Length:
12382 bp
Type:
Mammalian Expression, Synthetic Biology
Replication origin:
ori
Selection Marker:
Blasticidin
Copy Number:
High Copy
Promoter:
CAG
Cloning Method:
Restriction Enzyme
5' Primer:
ggcttctggcgtgtgaccggc
3' Primer:
catagcgtaaaaggagcaaca

AAVS1-Blasticidin-CAG-Flpe-ERT2 vector Map

AAVS1-Blasticidin-CAG-Flpe-ERT212382 bp60012001800240030003600420048005400600066007200780084009000960010200108001140012000HA-LSAT2ABlasticidin-S deaminasebGH poly(A) signalCMV enhancerchicken beta-actin promoterchimeric intronpCAG-FKozak sequenceFLPoERT2WPREhGH poly(A) signalBglob-pA-Rbeta-globin poly(A) signalM13 revlac operatorlac promoterCAP binding siteHA-RT7 promoterIn lacZ geneccdBNeo-RNeo-FAmpRoriL4440CAP binding sitelac promoterlac operatorM13 revT3 promoter

Plasmid Protocol

1. Centrifuge at 5,000×g for 5 min.

2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.

3. Close the tube and incubate for 10 minutes at room temperature.

4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.

5. Store the plasmid at -20 ℃.

6. The concentration of plasmid re-measurement sometimes differs from the nominal value, which may be due to the position of the lyophilized plasmid in the tube, the efficiency of the re-dissolution, the measurement bias, and adsorption on the wall of the tube, therefore, it is recommended to transform and extract the plasmid before using it

General Plasmid Transform Protocol

1. Take one 100μl of the competent cells and thaw it on ice for 10min, add 2μl of plasmid, then ice bath for 30min, then heat-shock it at 42℃ for 60s, do not stir, and then ice bath for 2min.

2. Add 900μl of LB liquid medium without antibiotics, and incubate at 37℃ for 45min (30℃ for 1-1.5 hours) with 180rpm shaking.

3. Centrifuge at 6000rpm for 5min, leave only 100μl of supernatant to resuspend the bacterial precipitate and spread it onto the target plasmid-resistant LB plate.

4. Invert the plate and incubate at 37℃ for 14h, or at 30℃ for 20h.

5. Pick a single colony into LB liquid medium, add the corresponding antibiotics, incubate at 220rpm for 14h, and extract the plasmid according to the experimental needs and the instructions of the plasmid extraction kit.

AAVS1-Blasticidin-CAG-Flpe-ERT2 vector Sequence

LOCUS       V010517                12382 bp    DNA     circular SYN 13-MAY-2021
DEFINITION  Exported.
ACCESSION   V010517
VERSION     V010517
KEYWORDS    AAVS1-Blasticidin-CAG-Flpe-ERT2
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
            .
REFERENCE   1  (bases 1 to 12382)
  AUTHORS   Chen Y, Cao J, Xiong M, Petersen AJ, Dong Y, Tao Y, Huang CT, Du Z,
            Zhang SC
  TITLE     Engineering Human Stem Cell Lines with Inducible Gene Knockout using
            CRISPR/Cas9.
  JOURNAL   Cell Stem Cell. 2015 Jul 1. pii: S1934-5909(15)00261-1. doi:
            10.1016/j.stem.2015.06.001.
   PUBMED   26145478
REFERENCE   2  (bases 1 to 12382)
  TITLE     Direct Submission
REFERENCE   3  (bases 1 to 12382)
  AUTHORS   .
  TITLE     Direct Submission
COMMENT     SGRef: number: 1; type: "Journal Article"; journalName: "Cell Stem
            Cell. 2015 Jul 1. pii: S1934-5909(15)00261-1. doi:
            10.1016/j.stem.2015.06.001."
            SGRef: number: 2; type: "Journal Article"
FEATURES             Location/Qualifiers
     source          1..12382
                     /mol_type="other DNA"
                     /organism="synthetic DNA construct"
     misc_feature    33..836
                     /label="HA-L"
                     /note="left homology arm from the adeno-associated virus
                     integration site (AAVS1) within intron 1 of the human
                     PPP1R12C gene"
     misc_feature    843..868
                     /label="SA"
                     /note="splice acceptor site"
     CDS             892..945
                     /label="T2A"
                     /note="2A peptide from Thosea asigna virus capsid protein"
     CDS             955..1374
                     /gene="bsr"
                     /label="Blasticidin-S deaminase"
                     /note="Blasticidin-S deaminase from Bacillus cereus.
                     Accession#: P33967"
     polyA_signal    1424..1648
                     /label="bGH poly(A) signal"
                     /note="bovine growth hormone polyadenylation signal"
     enhancer        1716..2095
                     /label="CMV enhancer"
                     /note="human cytomegalovirus immediate early enhancer"
     promoter        2097..2374
                     /label="chicken beta-actin promoter"
     intron          2376..3393
                     /label="chimeric intron"
                     /note="chimera between introns from chicken beta-actin and
                     rabbit beta-globin"
     primer_bind     3401..3420
                     /label="pCAG-F"
                     /note="Rabbit beta-globin intron, for pCAG plasmids,
                     forward primer"
     regulatory      3457..3466
                     /label="Kozak sequence"
                     /note="vertebrate consensus sequence for strong initiation
                     of translation (Kozak, 1987)"
                     /regulatory_class="other"
     CDS             3469..4737
                     /label="FLPo"
                     /note="nuclear-targeted site-specific recombinase"
     CDS             4762..5697
                     /label="ERT2"
                     /note="mutated ligand-binding domain of the human estrogen
                     receptor (Feil et al., 1997)"
     misc_feature    5737..6325
                     /label="WPRE"
                     /note="woodchuck hepatitis virus posttranscriptional
                     regulatory element"
     polyA_signal    6357..6833
                     /label="hGH poly(A) signal"
                     /note="human growth hormone polyadenylation signal"
     primer_bind     complement(6943..6962)
                     /label="Bglob-pA-R"
                     /note="Rabbit beta-globin polyA region, reverse primer"
     polyA_signal    7008..7063
                     /label="beta-globin poly(A) signal"
                     /note="rabbit beta-globin polyadenylation signal (Gil and
                     Proudfoot, 1987)"
     primer_bind     complement(7062..7081)
                     /label="rbglobpA-R"
                     /note="Rabbit beta-globin polyA, reverse primer. Also
                     called rb-glob-pA-term-R"
     primer_bind     complement(7424..7440)
                     /label="M13 rev"
                     /note="common sequencing primer, one of multiple similar
                     variants"
     protein_bind    7448..7464
                     /label="lac operator"
                     /bound_moiety="lac repressor encoded by lacI"
                     /note="The lac repressor binds to the lac operator to
                     inhibit transcription in E. coli. This inhibition can be
                     relieved by adding lactose or
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     promoter        complement(7472..7502)
                     /label="lac promoter"
                     /note="promoter for the E. coli lac operon"
     protein_bind    complement(7517..7538)
                     /label="CAP binding site"
                     /note="CAP binding activates transcription in the presence
                     of cAMP."
     misc_feature    7612..8448
                     /label="HA-R"
                     /note="right homology arm from the adeno-associated virus
                     integration site (AAVS1) within intron 1 of the human
                     PPP1R12C gene"
     promoter        complement(8489..8507)
                     /label="T7 promoter"
                     /note="promoter for bacteriophage T7 RNA polymerase"
     primer_bind     complement(8514..8531)
                     /label="M13 Forward"
                     /note="In lacZ gene. Also called M13-F20 or M13 (-21)
                     Forward"
     primer_bind     complement(8514..8530)
                     /label="M13 fwd"
                     /note="common sequencing primer, one of multiple similar
                     variants"
     primer_bind     complement(8523..8545)
                     /label="M13/pUC Forward"
                     /note="In lacZ gene"
     CDS             8668..8967
                     /label="ccdB"
                     /note="CcdB, a bacterial toxin that poisons DNA gyrase"
     primer_bind     complement(9373..9392)
                     /label="Neo-R"
                     /note="Neomycin resistance gene, reverse primer"
     primer_bind     9987..10006
                     /label="Neo-F"
                     /note="Neomycin resistance gene, forward primer"
     CDS             complement(10370..11227)
                     /label="AmpR"
                     /note="beta-lactamase"
     rep_origin      11351..11939
                     /label="ori"
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
                     replication"
     primer_bind     12093..12110
                     /label="L4440"
                     /note="L4440 vector, forward primer"
     protein_bind    12227..12248
                     /label="CAP binding site"
                     /note="CAP binding activates transcription in the presence
                     of cAMP."
     promoter        12263..12293
                     /label="lac promoter"
                     /note="promoter for the E. coli lac operon"
     protein_bind    12301..12317
                     /label="lac operator"
                     /note="The lac repressor binds to the lac operator to
                     inhibit transcription in E. coli. This inhibition can be
                     relieved by adding lactose or
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     primer_bind     12325..12341
                     /label="M13 rev"
                     /note="common sequencing primer, one of multiple similar
                     variants"
     promoter        12362..12380
                     /label="T3 promoter"
                     /note="promoter for bacteriophage T3 RNA polymerase"