Price Information
| Cat No. | Plasmid Name | Availability | Add to cart |
|---|---|---|---|
| V010555 | p46Cpf1-OP2 | In stock, 1 week for quality controls |
Buy one, get one free! |
Two tubes of lyophilized plasmid will be delivered, each tube is about 5µg.
Basic Vector Information
- Vector Name:
- p46Cpf1-OP2
- Antibiotic Resistance:
- Chloramphenicol
- Length:
- 10917 bp
- Type:
- Bacterial Expression, CRISPR
- Replication origin:
- pSC101 ori
- Copy Number:
- Low Copy
- Promoter:
- araBAD
- Cloning Method:
- Restriction Enzyme
- 5' Primer:
- pBAD-F (ATGCCATAGCATTTTTATCC)
- 3' Primer:
- rrnB-T1-term-Rev (GAAAGGCCCAGTCTTTCGAC)
p46Cpf1-OP2 vector Map
Plasmid Protocol
1. Centrifuge at 5,000×g for 5 min.
2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.
5. Store the plasmid at -20 ℃.
6. The concentration of plasmid re-measurement sometimes differs from the nominal value, which may be due to the position of the lyophilized plasmid in the tube, the efficiency of the re-dissolution, the measurement bias, and adsorption on the wall of the tube, therefore, it is recommended to transform and extract the plasmid before using it
General Plasmid Transform Protocol
1. Take one 100μl of the competent cells and thaw it on ice for 10min, add 2μl of plasmid, then ice bath for 30min, then heat-shock it at 42℃ for 60s, do not stir, and then ice bath for 2min.
2. Add 900μl of LB liquid medium without antibiotics, and incubate at 37℃ for 45min (30℃ for 1-1.5 hours) with 180rpm shaking.
3. Centrifuge at 6000rpm for 5min, leave only 100μl of supernatant to resuspend the bacterial precipitate and spread it onto the target plasmid-resistant LB plate.
4. Invert the plate and incubate at 37℃ for 14h, or at 30℃ for 20h.
5. Pick a single colony into LB liquid medium, add the corresponding antibiotics, incubate at 220rpm for 14h, and extract the plasmid according to the experimental needs and the instructions of the plasmid extraction kit.
p46Cpf1-OP2 vector Sequence
LOCUS V010555 10917 bp DNA circular SYN 13-MAY-2021
DEFINITION Exported.
ACCESSION V010555
VERSION V010555
KEYWORDS p46Cpf1-OP2
SOURCE synthetic DNA construct
ORGANISM synthetic DNA construct
.
REFERENCE 1 (bases 1 to 10917)
TITLE Qiong Wu CRISPR plasmids
JOURNAL Unpublished
REFERENCE 2 (bases 1 to 10917)
TITLE Direct Submission
REFERENCE 3 (bases 1 to 10917)
AUTHORS .
TITLE Direct Submission
COMMENT SGRef: number: 1; type: "Journal Article"; journalName:
"Unpublished"
SGRef: number: 2; type: "Journal Article"
FEATURES Location/Qualifiers
source 1..10917
/mol_type="other DNA"
/organism="synthetic DNA construct"
CDS complement(21..644)
/label="TetR"
/note="tetracycline repressor TetR"
promoter 660..715
/label="tetR/tetA promoters"
/note="overlapping promoters for bacterial tetR and tetA"
RBS 733..744
/note="strong bacterial ribosome binding site (Elowitz and
Leibler, 2000)"
CDS 758..1171
/label="Gam"
/note="inhibitor of the host RecBCD nuclease in the lambda
Red system"
CDS 1180..1962
/label="Beta"
/note="single-stranded DNA binding recombinase in the
lambda Red system"
CDS 1962..2639
/label="Exo"
/note="5' to 3' double-stranded DNA exonuclease in the
lambda Red system"
terminator 2643..2887
/label="lambda tL3 terminator"
/note="transcription terminator tL3 from phage lambda"
CDS complement(3029..3976)
/label="Rep101(Ts)"
/note="temperature-sensitive version of the RepA protein
needed for replication with the pSC101 origin (Armstrong et
al., 1984)"
rep_origin complement(4024..4246)
/direction=LEFT
/label="pSC101 ori"
/note="low-copy replication origin that requires the Rep101
protein"
terminator 4767..4861
/label="lambda t0 terminator"
/note="transcription terminator from phage lambda"
CDS complement(4875..5750)
/label="araC"
/note="L-arabinose regulatory protein"
promoter 5777..6061
/label="araBAD promoter"
/note="promoter of the L-arabinose operon of E. coli; the
araC regulatory gene is transcribed in the opposite
direction (Guzman et al., 1995)"
RBS 6083..6094
/note="strong bacterial ribosome binding site (Elowitz and
Leibler, 2000)"
CDS 6101..10000
/gene="cas12a"
/label="CRISPR-associated endonuclease Cas12a"
/note="CRISPR-associated endonuclease Cas12a from
Francisella tularensis subsp. novicida (strain U112).
Accession#: A0Q7Q2"
terminator 10015..10086
/label="rrnB T1 terminator"
/note="transcription terminator T1 from the E. coli rrnB
gene"
terminator 10102..10129
/label="T7Te terminator"
/note="phage T7 early transcription terminator"
CDS complement(10158..10814)
/label="CmR"
/note="chloramphenicol acetyltransferase"
promoter complement(10815..10917)
/label="cat promoter"
/note="promoter of the E. coli cat gene encoding
chloramphenicol acetyltransferase"