pQE-30-HyPer3 vector (V010059)

Price Information

Cat No. Plasmid Name Availability Add to cart
V010059 pQE-30-HyPer3 In stock, 1 week for quality controls

Buy one, get one free!

Two tubes of lyophilized plasmid will be delivered, each tube is about 5µg.

Basic Vector Information

Vector Name:
pQE-30-HyPer3
Antibiotic Resistance:
Ampicillin
Length:
4859 bp
Type:
Bacterial Expression
Replication origin:
ori
Copy Number:
High Copy
Promoter:
T5
Cloning Method:
Restriction Enzyme
5' Primer:
aggagaaattaactatgagagg
3' Primer:
ccagatggagttctgaggtc

pQE-30-HyPer3 vector Vector Map

pQE-30-HyPer34859 bp6001200180024003000360042004800T5 promoterlac operatorRBS6xHisHyPer-3lambda t0 terminatorCmRrrnB T1 terminatorpGEX 3'bomL4440oriAmpRAmpR promoterpBRforEco

Plasmid Protocol

1. Centrifuge at 5,000×g for 5 min.

2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.

3. Close the tube and incubate for 10 minutes at room temperature.

4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.

5. Store the plasmid at -20 ℃.

6. The concentration of plasmid re-measurement sometimes differs from the nominal value, which may be due to the position of the lyophilized plasmid in the tube, the efficiency of the re-dissolution, the measurement bias, and adsorption on the wall of the tube, therefore, it is recommended to transform and extract the plasmid before using it

General Plasmid Transform Protocol

1. Take one 100μl of the competent cells and thaw it on ice for 10min, add 2μl of plasmid, then ice bath for 30min, then heat-shock it at 42℃ for 60s, do not stir, and then ice bath for 2min.

2. Add 900μl of LB liquid medium without antibiotics, and incubate at 37℃ for 45min (30℃ for 1-1.5 hours) with 180rpm shaking.

3. Centrifuge at 6000rpm for 5min, leave only 100μl of supernatant to resuspend the bacterial precipitate and spread it onto the target plasmid-resistant LB plate.

4. Invert the plate and incubate at 37℃ for 14h, or at 30℃ for 20h.

5. Pick a single colony into LB liquid medium, add the corresponding antibiotics, incubate at 220rpm for 14h, and extract the plasmid according to the experimental needs and the instructions of the plasmid extraction kit.

pQE-30-HyPer3 vector Sequence

Copy Sequence

Download GeneBank File(.gb)

LOCUS       pQE-30-HyPer3.        4859 bp DNA     circular SYN 13-MAY-2021
DEFINITION  Genetically encoded H2O2 probe for ratiometric and fluorescence 
            lifetime imaging.
ACCESSION   .
VERSION     .
KEYWORDS    pQE-30-HyPer3
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 4859)
  AUTHORS   Bilan DS, Pase L, Joosen L, Gorokhovatsky AY, Ermakova YG, Gadella 
            TW, Grabher C, Schultz C, Lukyanov S, Belousov VV
  TITLE     HyPer-3: a genetically encoded H2O2 probe with improved performance 
            for ratiometric and fluorescence lifetime imaging.
  JOURNAL   ACS Chem Biol. 2012 Dec 20.
  PUBMED    23256573
REFERENCE   2  (bases 1 to 4859)
  TITLE     Direct Submission
REFERENCE   3  (bases 1 to 4859)
  AUTHORS   .
  TITLE     Direct Submission
COMMENT     SGRef: number: 1; type: "Journal Article"; journalName: "ACS Chem
            Biol. 2012 Dec 20."
COMMENT     SGRef: number: 2; type: "Journal Article"
FEATURES             Location/Qualifiers
     source          1..4859
                     /mol_type="other DNA"
                     /organism="synthetic DNA construct"
     promoter        10..54
                     /label=T5 promoter
                     /note="bacteriophage T5 promoter for E. coli RNA
                     polymerase, with embedded lac operator"
     protein_bind    62..78
                     /label=lac operator
                     /bound_moiety="lac repressor encoded by lacI"
                     /note="The lac repressor binds to the lac operator to
                     inhibit transcription in E. coli. This inhibition can be 
                     relieved by adding lactose or 
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     RBS             97..108
                     /note="strong bacterial ribosome binding site (Elowitz and 
                     Leibler, 2000)"
     CDS             127..144
                     /label=6xHis
                     /note="6xHis affinity tag"
     CDS             151..1581
                     /label=HyPer-3
                     /note="improved fluorescent indicator for intracellular
                     H2O2 (Bilan et al., 2013)"
     terminator      1606..1700
                     /label=lambda t0 terminator
                     /note="transcription terminator from phage lambda"
     CDS             1744..2400
                     /label=CmR
                     /note="chloramphenicol acetyltransferase"
     terminator      2468..2554
                     /label=rrnB T1 terminator
                     /note="transcription terminator T1 from the E. coli rrnB
                     gene"
     primer_bind     complement(2601..2623)
                     /label=pGEX 3'
                     /note="pGEX vectors, reverse primer"
     misc_feature    2709..2849
                     /label=bom
                     /note="basis of mobility region from pBR322"
     primer_bind     complement(2864..2881)
                     /label=L4440
                     /note="L4440 vector, forward primer"
     rep_origin      complement(3035..3623)
                     /direction=LEFT
                     /label=ori
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of 
                     replication"
     CDS             complement(3797..4654)
                     /label=AmpR
                     /note="beta-lactamase"
     promoter        complement(4655..4759)
                     /label=AmpR promoter
     primer_bind     4827..4845
                     /label=pBRforEco
                     /note="pBR322 vectors, upsteam of EcoRI site, forward
                     primer"