Price Information
Cat No. | Plasmid Name | Availability | Add to cart |
---|---|---|---|
V010059 | pQE-30-HyPer3 | In stock, 1 week for quality controls |
Buy one, get one free! |
Two tubes of lyophilized plasmid will be delivered, each tube is about 5µg.
Basic Vector Information
- Vector Name:
- pQE-30-HyPer3
- Antibiotic Resistance:
- Ampicillin
- Length:
- 4859 bp
- Type:
- Bacterial Expression
- Replication origin:
- ori
- Copy Number:
- High Copy
- Promoter:
- T5
- Cloning Method:
- Restriction Enzyme
- 5' Primer:
- aggagaaattaactatgagagg
- 3' Primer:
- ccagatggagttctgaggtc
pQE-30-HyPer3 vector Vector Map
Plasmid Protocol
1. Centrifuge at 5,000×g for 5 min.
2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.
5. Store the plasmid at -20 ℃.
6. The concentration of plasmid re-measurement sometimes differs from the nominal value, which may be due to the position of the lyophilized plasmid in the tube, the efficiency of the re-dissolution, the measurement bias, and adsorption on the wall of the tube, therefore, it is recommended to transform and extract the plasmid before using it
General Plasmid Transform Protocol
1. Take one 100μl of the competent cells and thaw it on ice for 10min, add 2μl of plasmid, then ice bath for 30min, then heat-shock it at 42℃ for 60s, do not stir, and then ice bath for 2min.
2. Add 900μl of LB liquid medium without antibiotics, and incubate at 37℃ for 45min (30℃ for 1-1.5 hours) with 180rpm shaking.
3. Centrifuge at 6000rpm for 5min, leave only 100μl of supernatant to resuspend the bacterial precipitate and spread it onto the target plasmid-resistant LB plate.
4. Invert the plate and incubate at 37℃ for 14h, or at 30℃ for 20h.
5. Pick a single colony into LB liquid medium, add the corresponding antibiotics, incubate at 220rpm for 14h, and extract the plasmid according to the experimental needs and the instructions of the plasmid extraction kit.
pQE-30-HyPer3 vector Sequence
LOCUS pQE-30-HyPer3. 4859 bp DNA circular SYN 13-MAY-2021 DEFINITION Genetically encoded H2O2 probe for ratiometric and fluorescence lifetime imaging. ACCESSION . VERSION . KEYWORDS pQE-30-HyPer3 SOURCE synthetic DNA construct ORGANISM synthetic DNA construct REFERENCE 1 (bases 1 to 4859) AUTHORS Bilan DS, Pase L, Joosen L, Gorokhovatsky AY, Ermakova YG, Gadella TW, Grabher C, Schultz C, Lukyanov S, Belousov VV TITLE HyPer-3: a genetically encoded H2O2 probe with improved performance for ratiometric and fluorescence lifetime imaging. JOURNAL ACS Chem Biol. 2012 Dec 20. PUBMED 23256573 REFERENCE 2 (bases 1 to 4859) TITLE Direct Submission REFERENCE 3 (bases 1 to 4859) AUTHORS . TITLE Direct Submission COMMENT SGRef: number: 1; type: "Journal Article"; journalName: "ACS Chem Biol. 2012 Dec 20." COMMENT SGRef: number: 2; type: "Journal Article" FEATURES Location/Qualifiers source 1..4859 /mol_type="other DNA" /organism="synthetic DNA construct" promoter 10..54 /label=T5 promoter /note="bacteriophage T5 promoter for E. coli RNA polymerase, with embedded lac operator" protein_bind 62..78 /label=lac operator /bound_moiety="lac repressor encoded by lacI" /note="The lac repressor binds to the lac operator to inhibit transcription in E. coli. This inhibition can be relieved by adding lactose or isopropyl-beta-D-thiogalactopyranoside (IPTG)." RBS 97..108 /note="strong bacterial ribosome binding site (Elowitz and Leibler, 2000)" CDS 127..144 /label=6xHis /note="6xHis affinity tag" CDS 151..1581 /label=HyPer-3 /note="improved fluorescent indicator for intracellular H2O2 (Bilan et al., 2013)" terminator 1606..1700 /label=lambda t0 terminator /note="transcription terminator from phage lambda" CDS 1744..2400 /label=CmR /note="chloramphenicol acetyltransferase" terminator 2468..2554 /label=rrnB T1 terminator /note="transcription terminator T1 from the E. coli rrnB gene" primer_bind complement(2601..2623) /label=pGEX 3' /note="pGEX vectors, reverse primer" misc_feature 2709..2849 /label=bom /note="basis of mobility region from pBR322" primer_bind complement(2864..2881) /label=L4440 /note="L4440 vector, forward primer" rep_origin complement(3035..3623) /direction=LEFT /label=ori /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of replication" CDS complement(3797..4654) /label=AmpR /note="beta-lactamase" promoter complement(4655..4759) /label=AmpR promoter primer_bind 4827..4845 /label=pBRforEco /note="pBR322 vectors, upsteam of EcoRI site, forward primer"