LZRS ERTm RasV12 vector (Cat. No.: V001299)

LZRS ERTm RasV1212382 bp60012001800240030003600420048005400600066007200780084009000960010200108001140012000Estrogen receptorH-Ras (G12V)LTRL4440oriSV40 poly(A) signalPuroRPGK promoteroriPAmpRAmpR promoterLTRMMLV Psigag (truncated)
Basic Information
Name:
LZRS ERTm RasV12
Antibiotic Resistance:
Ampicillin
Length:
12382 bp
Type:
Retroviral
Replication origin:
ori
Selection Marker:
Puromycin
Copy Number:
Low Copy
Promoter:
mPGK
Cloning Method:
Restriction Enzyme
5' Primer:
TGGATACACGCCGCCCACGTG
3' Primer:
ATCGTCGACCACTGTGCTGG
$ 249.6
In stock, 1 week for quality controls
Buy one, get one free! (?)
Two tubes of lyophilized plasmid will be delivered, each tube is about 5µg.

Plasmid Protocol

1. Centrifuge at 5,000×g for 5 min.

2. Carefully open the tube and add sterile water to dissolve the DNA: add 20 μl for 5 μg plasmid, and 100 μl for 100 μg plasmid.

3. Close the tube and incubate for 10 minutes at room temperature.

4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.

5. Store the plasmid at -20 ℃.

6. The concentration of plasmid re-measurement sometimes differs from the nominal value, which may be due to the position of the lyophilized plasmid in the tube, the efficiency of the re-dissolution, the measurement bias, and adsorption on the wall of the tube, therefore, it is recommended to transform and extract the plasmid before using it

General Plasmid Transform Protocol

1. Take one 100μl of the competent cells and thaw it on ice for 10min, add 2μl of plasmid, then ice bath for 30min, then heat-shock it at 42℃ for 60s, do not stir, and then ice bath for 2min.

2. Add 900μl of LB liquid medium without antibiotics, and incubate at 37℃ for 45min (30℃ for 1-1.5 hours) with 180rpm shaking.

3. Centrifuge at 6000rpm for 5min, leave only 100μl of supernatant to resuspend the bacterial precipitate and spread it onto the target plasmid-resistant LB plate.

4. Invert the plate and incubate at 37℃ for 14h, or at 30℃ for 20h.

5. Pick a single colony into LB liquid medium, add the corresponding antibiotics, incubate at 220rpm for 14h, and extract the plasmid according to the experimental needs and the instructions of the plasmid extraction kit.

LZRS ERTm RasV12 vector (Cat. No.: V001299) Sequence

LOCUS       V001299                12382 bp    DNA     circular SYN 13-MAY-2021
DEFINITION  Exported.
ACCESSION   V001299
VERSION     V001299
KEYWORDS    LZRS ERTm RasV12
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
            .
REFERENCE   1  (bases 1 to 12382)
  AUTHORS   Dajee M, Tarutani M, Deng H, Cai T, Khavari PA
  TITLE     Epidermal Ras blockade demonstrates spatially localized Ras
            promotion of proliferation and inhibition of differentiation
  JOURNAL   Oncogene. 2002 Feb 28;21(10):1527-38
   PUBMED   11896581
REFERENCE   2  (bases 1 to 12382)
  TITLE     Direct Submission
REFERENCE   3  (bases 1 to 12382)
  AUTHORS   .
  TITLE     Direct Submission
COMMENT     SGRef: number: 1; type: "Journal Article"; journalName: "Oncogene.";
            date: "2002-02-28"; volume: "21(10)"; pages: "1527-3"
            SGRef: number: 2; type: "Journal Article"
FEATURES             Location/Qualifiers
     source          1..12382
                     /mol_type="other DNA"
                     /organism="synthetic DNA construct"
     CDS             445..807
                     /gene="ESR1"
                     /label="Estrogen receptor"
                     /note="Estrogen receptor from Macaca mulatta. Accession#:
                     P49886"
     CDS             1045..1611
                     /label="H-Ras (G12V)"
                     /note="human oncoprotein generated by the G12V mutation in
                     the small GTPase H-Ras"
     LTR             1713..2304
                     /label="LTR"
                     /note="long terminal repeat from Moloney murine leukemia
                     virus"
     primer_bind     complement(2434..2451)
                     /label="L4440"
                     /note="L4440 vector, forward primer"
     rep_origin      complement(2605..3193)
                     /direction=LEFT
                     /label="ori"
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
                     replication"
     polyA_signal    complement(3316..3450)
                     /label="SV40 poly(A) signal"
                     /note="SV40 polyadenylation signal"
     CDS             complement(3683..4279)
                     /label="PuroR"
                     /note="puromycin N-acetyltransferase"
     promoter        complement(4362..4861)
                     /label="PGK promoter"
                     /note="mouse phosphoglycerate kinase 1 promoter"
     rep_origin      6893..8682
                     /label="oriP"
                     /note="Epstein-Barr virus oriP replication origin (Yates et
                     al., 2000)"
     CDS             complement(9179..10036)
                     /label="AmpR"
                     /note="beta-lactamase"
     promoter        complement(10037..10141)
                     /label="AmpR promoter"
     LTR             10557..11149
                     /label="LTR"
                     /note="long terminal repeat from Moloney murine leukemia
                     virus"
     misc_feature    11212..11569
                     /label="MMLV Psi"
                     /note="packaging signal of Moloney murine leukemia virus
                     (MMLV)"
     CDS             11634..12050
                     /label="gag (truncated)"
                     /note="truncated Moloney murine leukemia virus (MMLV) gag
                     gene lacking the start codon"