LZRS ERTm RasV12 vector (Cat. No.: V001299)
- Name:
- LZRS ERTm RasV12
- Antibiotic Resistance:
- Ampicillin
- Length:
- 12382 bp
- Type:
- Retroviral
- Replication origin:
- ori
- Selection Marker:
- Puromycin
- Copy Number:
- Low Copy
- Promoter:
- mPGK
- Cloning Method:
- Restriction Enzyme
- 5' Primer:
- TGGATACACGCCGCCCACGTG
- 3' Primer:
- ATCGTCGACCACTGTGCTGG
Resources
Plasmid Protocol
1. Centrifuge at 5,000×g for 5 min.
2. Carefully open the tube and add sterile water to dissolve the DNA: add 20 μl for 5 μg plasmid, and 100 μl for 100 μg plasmid.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.
5. Store the plasmid at -20 ℃.
6. The concentration of plasmid re-measurement sometimes differs from the nominal value, which may be due to the position of the lyophilized plasmid in the tube, the efficiency of the re-dissolution, the measurement bias, and adsorption on the wall of the tube, therefore, it is recommended to transform and extract the plasmid before using it
General Plasmid Transform Protocol
1. Take one 100μl of the competent cells and thaw it on ice for 10min, add 2μl of plasmid, then ice bath for 30min, then heat-shock it at 42℃ for 60s, do not stir, and then ice bath for 2min.
2. Add 900μl of LB liquid medium without antibiotics, and incubate at 37℃ for 45min (30℃ for 1-1.5 hours) with 180rpm shaking.
3. Centrifuge at 6000rpm for 5min, leave only 100μl of supernatant to resuspend the bacterial precipitate and spread it onto the target plasmid-resistant LB plate.
4. Invert the plate and incubate at 37℃ for 14h, or at 30℃ for 20h.
5. Pick a single colony into LB liquid medium, add the corresponding antibiotics, incubate at 220rpm for 14h, and extract the plasmid according to the experimental needs and the instructions of the plasmid extraction kit.
LZRS ERTm RasV12 vector (Cat. No.: V001299) Sequence
LOCUS V001299 12382 bp DNA circular SYN 13-MAY-2021
DEFINITION Exported.
ACCESSION V001299
VERSION V001299
KEYWORDS LZRS ERTm RasV12
SOURCE synthetic DNA construct
ORGANISM synthetic DNA construct
.
REFERENCE 1 (bases 1 to 12382)
AUTHORS Dajee M, Tarutani M, Deng H, Cai T, Khavari PA
TITLE Epidermal Ras blockade demonstrates spatially localized Ras
promotion of proliferation and inhibition of differentiation
JOURNAL Oncogene. 2002 Feb 28;21(10):1527-38
PUBMED 11896581
REFERENCE 2 (bases 1 to 12382)
TITLE Direct Submission
REFERENCE 3 (bases 1 to 12382)
AUTHORS .
TITLE Direct Submission
COMMENT SGRef: number: 1; type: "Journal Article"; journalName: "Oncogene.";
date: "2002-02-28"; volume: "21(10)"; pages: "1527-3"
SGRef: number: 2; type: "Journal Article"
FEATURES Location/Qualifiers
source 1..12382
/mol_type="other DNA"
/organism="synthetic DNA construct"
CDS 445..807
/gene="ESR1"
/label="Estrogen receptor"
/note="Estrogen receptor from Macaca mulatta. Accession#:
P49886"
CDS 1045..1611
/label="H-Ras (G12V)"
/note="human oncoprotein generated by the G12V mutation in
the small GTPase H-Ras"
LTR 1713..2304
/label="LTR"
/note="long terminal repeat from Moloney murine leukemia
virus"
primer_bind complement(2434..2451)
/label="L4440"
/note="L4440 vector, forward primer"
rep_origin complement(2605..3193)
/direction=LEFT
/label="ori"
/note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
replication"
polyA_signal complement(3316..3450)
/label="SV40 poly(A) signal"
/note="SV40 polyadenylation signal"
CDS complement(3683..4279)
/label="PuroR"
/note="puromycin N-acetyltransferase"
promoter complement(4362..4861)
/label="PGK promoter"
/note="mouse phosphoglycerate kinase 1 promoter"
rep_origin 6893..8682
/label="oriP"
/note="Epstein-Barr virus oriP replication origin (Yates et
al., 2000)"
CDS complement(9179..10036)
/label="AmpR"
/note="beta-lactamase"
promoter complement(10037..10141)
/label="AmpR promoter"
LTR 10557..11149
/label="LTR"
/note="long terminal repeat from Moloney murine leukemia
virus"
misc_feature 11212..11569
/label="MMLV Psi"
/note="packaging signal of Moloney murine leukemia virus
(MMLV)"
CDS 11634..12050
/label="gag (truncated)"
/note="truncated Moloney murine leukemia virus (MMLV) gag
gene lacking the start codon"