Price Information
Cat No. | Plasmid Name | Availability | Buy one, get one free! (?) |
---|---|---|---|
V001299 | LZRS ERTm RasV12 | In stock, 1 week for quality controls |
Two tubes of lyophilized plasmid will be delivered, each tube is about 5µg.
Basic Vector Information
- Vector Name:
- LZRS ERTm RasV12
- Antibiotic Resistance:
- Ampicillin
- Length:
- 12382 bp
- Type:
- Retroviral
- Replication origin:
- ori
- Selection Marker:
- Puromycin
- Copy Number:
- Low Copy
- Promoter:
- mPGK
- Cloning Method:
- Restriction Enzyme
- 5' Primer:
- TGGATACACGCCGCCCACGTG
- 3' Primer:
- ATCGTCGACCACTGTGCTGG
LZRS ERTm RasV12 vector Map
Plasmid Protocol
1. Centrifuge at 5,000×g for 5 min.
2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.
5. Store the plasmid at -20 ℃.
6. The concentration of plasmid re-measurement sometimes differs from the nominal value, which may be due to the position of the lyophilized plasmid in the tube, the efficiency of the re-dissolution, the measurement bias, and adsorption on the wall of the tube, therefore, it is recommended to transform and extract the plasmid before using it
General Plasmid Transform Protocol
1. Take one 100μl of the competent cells and thaw it on ice for 10min, add 2μl of plasmid, then ice bath for 30min, then heat-shock it at 42℃ for 60s, do not stir, and then ice bath for 2min.
2. Add 900μl of LB liquid medium without antibiotics, and incubate at 37℃ for 45min (30℃ for 1-1.5 hours) with 180rpm shaking.
3. Centrifuge at 6000rpm for 5min, leave only 100μl of supernatant to resuspend the bacterial precipitate and spread it onto the target plasmid-resistant LB plate.
4. Invert the plate and incubate at 37℃ for 14h, or at 30℃ for 20h.
5. Pick a single colony into LB liquid medium, add the corresponding antibiotics, incubate at 220rpm for 14h, and extract the plasmid according to the experimental needs and the instructions of the plasmid extraction kit.
LZRS ERTm RasV12 vector Sequence
LOCUS V001299 12382 bp DNA circular SYN 13-MAY-2021 DEFINITION Exported. ACCESSION V001299 VERSION V001299 KEYWORDS LZRS ERTm RasV12 SOURCE synthetic DNA construct ORGANISM synthetic DNA construct . REFERENCE 1 (bases 1 to 12382) AUTHORS Dajee M, Tarutani M, Deng H, Cai T, Khavari PA TITLE Epidermal Ras blockade demonstrates spatially localized Ras promotion of proliferation and inhibition of differentiation JOURNAL Oncogene. 2002 Feb 28;21(10):1527-38 PUBMED 11896581 REFERENCE 2 (bases 1 to 12382) TITLE Direct Submission REFERENCE 3 (bases 1 to 12382) AUTHORS . TITLE Direct Submission COMMENT SGRef: number: 1; type: "Journal Article"; journalName: "Oncogene."; date: "2002-02-28"; volume: "21(10)"; pages: "1527-3" SGRef: number: 2; type: "Journal Article" FEATURES Location/Qualifiers source 1..12382 /mol_type="other DNA" /organism="synthetic DNA construct" CDS 445..807 /gene="ESR1" /label="Estrogen receptor" /note="Estrogen receptor from Macaca mulatta. Accession#: P49886" CDS 1045..1611 /label="H-Ras (G12V)" /note="human oncoprotein generated by the G12V mutation in the small GTPase H-Ras" LTR 1713..2304 /label="LTR" /note="long terminal repeat from Moloney murine leukemia virus" primer_bind complement(2434..2451) /label="L4440" /note="L4440 vector, forward primer" rep_origin complement(2605..3193) /direction=LEFT /label="ori" /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of replication" polyA_signal complement(3316..3450) /label="SV40 poly(A) signal" /note="SV40 polyadenylation signal" CDS complement(3683..4279) /label="PuroR" /note="puromycin N-acetyltransferase" promoter complement(4362..4861) /label="PGK promoter" /note="mouse phosphoglycerate kinase 1 promoter" rep_origin 6893..8682 /label="oriP" /note="Epstein-Barr virus oriP replication origin (Yates et al., 2000)" CDS complement(9179..10036) /label="AmpR" /note="beta-lactamase" promoter complement(10037..10141) /label="AmpR promoter" LTR 10557..11149 /label="LTR" /note="long terminal repeat from Moloney murine leukemia virus" misc_feature 11212..11569 /label="MMLV Psi" /note="packaging signal of Moloney murine leukemia virus (MMLV)" CDS 11634..12050 /label="gag (truncated)" /note="truncated Moloney murine leukemia virus (MMLV) gag gene lacking the start codon"