pSIP403 vector (V011282)

Price Information

Cat No. Plasmid Name Availability Add to cart
V011282 pSIP403 In stock, instant shipping

Buy one, get one free!

Two tubes of lyophilized plasmid will be delivered, each tube is about 5µg.

Basic Vector Information

The pSIP403 is for expression of gene of interest in Lactobacillus plantarum and L. sakei.

Vector Name:
pSIP403
Antibiotic Resistance:
Erythromycin
Length:
7435 bp
Type:
Bacterial Expression
Replication origin:
ori
Promoter:
sppA
Cloning Method:
Restriction Enzyme
5' Primer:
GGCTTTTATAATATGAGATAATGCCGAC
Growth Strain(s):
JM108
Growth Temperature:
37℃

pSIP403 vector Vector Map

pSIP4037435 bp300600900120015001800210024002700300033003600390042004500480051005400570060006300660069007200GUSorirRNA adenine N-6-methyltransferase

Plasmid Protocol

1. Centrifuge at 5,000×g for 5 min.

2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.

3. Close the tube and incubate for 10 minutes at room temperature.

4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.

5. Store the plasmid at -20 ℃.

6. The concentration of plasmid re-measurement sometimes differs from the nominal value, which may be due to the position of the lyophilized plasmid in the tube, the efficiency of the re-dissolution, the measurement bias, and adsorption on the wall of the tube, therefore, it is recommended to transform and extract the plasmid before using it

General Plasmid Transform Protocol

1. Take one 100μl of the competent cells and thaw it on ice for 10min, add 2μl of plasmid, then ice bath for 30min, then heat-shock it at 42℃ for 60s, do not stir, and then ice bath for 2min.

2. Add 900μl of LB liquid medium without antibiotics, and incubate at 37℃ for 45min (30℃ for 1-1.5 hours) with 180rpm shaking.

3. Centrifuge at 6000rpm for 5min, leave only 100μl of supernatant to resuspend the bacterial precipitate and spread it onto the target plasmid-resistant LB plate.

4. Invert the plate and incubate at 37℃ for 14h, or at 30℃ for 20h.

5. Pick a single colony into LB liquid medium, add the corresponding antibiotics, incubate at 220rpm for 14h, and extract the plasmid according to the experimental needs and the instructions of the plasmid extraction kit.

References

  • Sørvig E, Mathiesen G, Naterstad K, Eijsink VGH, Axelsson L. High-level, inducible gene expression in Lactobacillus sakei and Lactobacillus plantarum using versatile expression vectors. Microbiology (Reading). 2005 Jul;151(Pt 7):2439-2449.

pSIP403 vector Sequence

Copy Sequence

Download GeneBank File(.gb)

LOCUS       V011282                 7435 bp    DNA     circular SYN 13-MAY-2021
DEFINITION  Exported.
ACCESSION   V011282
VERSION     V011282
KEYWORDS    pSIP403
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
            .
REFERENCE   1  (bases 1 to 7435)
  AUTHORS   Sorvig E, Mathiesen G, Naterstad K, Eijsink VG, Axelsson L
  TITLE     High-level, inducible gene expression in Lactobacillus sakei and
            Lactobacillus plantarum using versatile expression vectors.
  JOURNAL   Microbiology. 2005 Jul;151(Pt 7):2439-49. doi:
            10.1099/mic.0.28084-0.
   PUBMED   16000734
REFERENCE   2  (bases 1 to 7435)
  TITLE     Direct Submission
REFERENCE   3  (bases 1 to 7435)
  AUTHORS   .
  TITLE     Direct Submission
COMMENT     SGRef: number: 1; type: "Journal Article"; journalName:
            "Microbiology."; date: "2005-07"; pages: " 10.1099/mic.0.28084-0"
            SGRef: number: 2; type: "Journal Article"
FEATURES             Location/Qualifiers
     source          1..7435
                     /mol_type="other DNA"
                     /organism="synthetic DNA construct"
     CDS             575..2374
                     /label="GUS"
                     /note="beta-glucuronidase"
     rep_origin      2731..3319
                     /direction=RIGHT
                     /label="ori"
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
                     replication"
     CDS             4508..5242
                     /gene="ermBP"
                     /label="rRNA adenine N-6-methyltransferase"
                     /note="rRNA adenine N-6-methyltransferase from Enterococcus
                     faecalis. Accession#: P0A4D5"