Price Information
Cat No. | Plasmid Name | Availability | Add to cart |
---|---|---|---|
V012812 | pAAV-Ef1a-fDIO EYFP | In stock, 1 week for quality controls |
Buy one, get one free! |
Two tubes of lyophilized plasmid will be delivered, each tube is about 5µg.
Basic Vector Information
EF1a-driven, Flp-dependent expression of EYFP.
- Vector Name:
- pAAV-Ef1a-fDIO EYFP
- Antibiotic Resistance:
- Ampicillin
- Length:
- 6313 bp
- Type:
- Mammalian Expression Vectors
- Replication origin:
- ori
- Source/Author:
- Karl Deisseroth
- Copy Number:
- High copy number
- Promoter:
- EF-1α
- Cloning Method:
- Enzyme Cut
- 5' Primer:
- CACCCACACAAAGGAAAAGGGCC
- 3' Primer:
- GCAATAGCATGATACAAAGG
pAAV-Ef1a-fDIO EYFP vector Vector Map
Plasmid Protocol
1. Centrifuge at 5,000×g for 5 min.
2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.
5. Store the plasmid at -20 ℃.
6. The concentration of plasmid re-measurement sometimes differs from the nominal value, which may be due to the position of the lyophilized plasmid in the tube, the efficiency of the re-dissolution, the measurement bias, and adsorption on the wall of the tube, therefore, it is recommended to transform and extract the plasmid before using it
General Plasmid Transform Protocol
1. Take one 100μl of the competent cells and thaw it on ice for 10min, add 2μl of plasmid, then ice bath for 30min, then heat-shock it at 42℃ for 60s, do not stir, and then ice bath for 2min.
2. Add 900μl of LB liquid medium without antibiotics, and incubate at 37℃ for 45min (30℃ for 1-1.5 hours) with 180rpm shaking.
3. Centrifuge at 6000rpm for 5min, leave only 100μl of supernatant to resuspend the bacterial precipitate and spread it onto the target plasmid-resistant LB plate.
4. Invert the plate and incubate at 37℃ for 14h, or at 30℃ for 20h.
5. Pick a single colony into LB liquid medium, add the corresponding antibiotics, incubate at 220rpm for 14h, and extract the plasmid according to the experimental needs and the instructions of the plasmid extraction kit.
pAAV-Ef1a-fDIO EYFP vector Sequence
LOCUS pAAV-Ef1a-fDIO_E 6313 bp DNA circular SYN 12-MAY-2021 DEFINITION Flp-Dependent EYFP. ACCESSION . VERSION . KEYWORDS pAAV-Ef1a-fDIO EYFP SOURCE synthetic DNA construct ORGANISM synthetic DNA construct REFERENCE 1 (bases 1 to 6313) AUTHORS Fenno LE, Mattis J, Ramakrishnan C, Hyun M, Lee SY, He M, Tucciarone J, Selimbeyoglu A, Berndt A, Grosenick L, Zalocusky KA, Bernstein H, Swanson H, Perry C, Diester I, Boyce FM, Bass CE, Neve R, Huang ZJ, Deisseroth K TITLE Targeting cells with single vectors using multiple-feature Boolean logic. JOURNAL Nat Methods. 2014 Jul;11(7):763-72. doi: 10.1038/nmeth.2996. Epub 2014 Jun 8. PUBMED 24908100 REFERENCE 2 (bases 1 to 6313) AUTHORS . TITLE Direct Submission COMMENT SGRef: number: 1; type: "Journal Article"; doi: "10.1038/nmeth.2996"; journalName: "Nat Methods"; date: "2014-07"; volume: "11"; issue: "7"; pages: "763-72" FEATURES Location/Qualifiers source 1..6313 /mol_type="other DNA" /organism="synthetic DNA construct" promoter 1..1179 /label=EF-1-alpha promoter /note="strong constitutive promoter for human elongation factor EF-1-alpha" protein_bind 1210..1243 /label=FRT (minimal) /note="supports FLP-mediated excision but not integration (Turan and Bode, 2011)" CDS complement(1339..2055) /label=EYFP /note="enhanced YFP" protein_bind complement(2068..2101) /label=FRT (minimal) /note="supports FLP-mediated excision but not integration (Turan and Bode, 2011)" misc_feature 2210..2798 /label=WPRE /note="woodchuck hepatitis virus posttranscriptional regulatory element" polyA_signal 2830..3306 /label=hGH poly(A) signal /note="human growth hormone polyadenylation signal" repeat_region 3346..3486 /label=AAV2 ITR /note="inverted terminal repeat of adeno-associated virus serotype 2" rep_origin 3561..4016 /label=f1 ori /note="f1 bacteriophage origin of replication; arrow indicates direction of (+) strand synthesis" promoter 4298..4402 /label=AmpR promoter CDS 4403..5260 /label=AmpR /note="beta-lactamase" rep_origin 5434..6022 /label=ori /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of replication" repeat_region 6084..6213 /label=AAV2 ITR (alternate) /note="AAV2 ITR (alternate)" /note="Functional equivalent of wild-type AAV2 ITR" promoter 6313 /label=EF-1-alpha promoter /note="strong constitutive promoter for human elongation factor EF-1-alpha"