pAAV-Ef1a-fDIO EYFP vector (V012812)

Price Information

Cat No. Plasmid Name Availability Add to cart
V012812 pAAV-Ef1a-fDIO EYFP In stock, 1 week for quality controls

Buy one, get one free!

Two tubes of lyophilized plasmid will be delivered, each tube is about 5µg.

Basic Vector Information

EF1a-driven, Flp-dependent expression of EYFP.

Vector Name:
pAAV-Ef1a-fDIO EYFP
Antibiotic Resistance:
Ampicillin
Length:
6313 bp
Type:
Mammalian Expression Vectors
Replication origin:
ori
Source/Author:
Karl Deisseroth
Copy Number:
High copy number
Promoter:
EF-1α
Cloning Method:
Enzyme Cut
5' Primer:
CACCCACACAAAGGAAAAGGGCC
3' Primer:
GCAATAGCATGATACAAAGG

pAAV-Ef1a-fDIO EYFP vector Map

pAAV-Ef1a-fDIO EYFP6313 bp300600900120015001800210024002700300033003600390042004500480051005400570060006300EF-1-alpha promoterEF-1-alpha promoterFRT (minimal)EYFPFRT (minimal)WPREhGH poly(A) signalAAV2 ITRf1 oriAmpR promoterAmpRoriAAV2 ITR (alternate)

Plasmid Protocol

1. Centrifuge at 5,000×g for 5 min.

2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.

3. Close the tube and incubate for 10 minutes at room temperature.

4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.

5. Store the plasmid at -20 ℃.

6. The concentration of plasmid re-measurement sometimes differs from the nominal value, which may be due to the position of the lyophilized plasmid in the tube, the efficiency of the re-dissolution, the measurement bias, and adsorption on the wall of the tube, therefore, it is recommended to transform and extract the plasmid before using it

General Plasmid Transform Protocol

1. Take one 100μl of the competent cells and thaw it on ice for 10min, add 2μl of plasmid, then ice bath for 30min, then heat-shock it at 42℃ for 60s, do not stir, and then ice bath for 2min.

2. Add 900μl of LB liquid medium without antibiotics, and incubate at 37℃ for 45min (30℃ for 1-1.5 hours) with 180rpm shaking.

3. Centrifuge at 6000rpm for 5min, leave only 100μl of supernatant to resuspend the bacterial precipitate and spread it onto the target plasmid-resistant LB plate.

4. Invert the plate and incubate at 37℃ for 14h, or at 30℃ for 20h.

5. Pick a single colony into LB liquid medium, add the corresponding antibiotics, incubate at 220rpm for 14h, and extract the plasmid according to the experimental needs and the instructions of the plasmid extraction kit.

pAAV-Ef1a-fDIO EYFP vector Sequence

Copy Sequence

Download GenBank File(.gb)

LOCUS       pAAV-Ef1a-fDIO_E        6313 bp DNA     circular SYN 12-MAY-2021
DEFINITION  Flp-Dependent EYFP.
ACCESSION   .
VERSION     .
KEYWORDS    pAAV-Ef1a-fDIO EYFP
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 6313)
  AUTHORS   Fenno LE, Mattis J, Ramakrishnan C, Hyun M, Lee SY, He M, Tucciarone
            J, Selimbeyoglu A, Berndt A, Grosenick L, Zalocusky KA, Bernstein H,
            Swanson H, Perry C, Diester I, Boyce FM, Bass CE, Neve R, Huang ZJ, 
            Deisseroth K
  TITLE     Targeting cells with single vectors using multiple-feature Boolean 
            logic.
  JOURNAL   Nat Methods. 2014 Jul;11(7):763-72. doi: 10.1038/nmeth.2996. Epub 
            2014 Jun 8.
  PUBMED    24908100
REFERENCE   2  (bases 1 to 6313)
  AUTHORS   .
  TITLE     Direct Submission
COMMENT     SGRef: number: 1; type: "Journal Article"; doi: 
            "10.1038/nmeth.2996"; journalName: "Nat Methods"; date: "2014-07"; 
            volume: "11"; issue: "7"; pages: "763-72"
FEATURES             Location/Qualifiers
     source          1..6313
                     /mol_type="other DNA"
                     /organism="synthetic DNA construct"
     promoter        1..1179
                     /label=EF-1-alpha promoter
                     /note="strong constitutive promoter for human elongation
                     factor EF-1-alpha"
     protein_bind    1210..1243
                     /label=FRT (minimal)
                     /note="supports FLP-mediated excision but not integration
                     (Turan and Bode, 2011)"
     CDS             complement(1339..2055)
                     /label=EYFP
                     /note="enhanced YFP"
     protein_bind    complement(2068..2101)
                     /label=FRT (minimal)
                     /note="supports FLP-mediated excision but not integration
                     (Turan and Bode, 2011)"
     misc_feature    2210..2798
                     /label=WPRE
                     /note="woodchuck hepatitis virus posttranscriptional
                     regulatory element"
     polyA_signal    2830..3306
                     /label=hGH poly(A) signal
                     /note="human growth hormone polyadenylation signal"
     repeat_region   3346..3486
                     /label=AAV2 ITR
                     /note="inverted terminal repeat of adeno-associated virus 
                     serotype 2"
     rep_origin      3561..4016
                     /label=f1 ori
                     /note="f1 bacteriophage origin of replication; arrow
                     indicates direction of (+) strand synthesis"
     promoter        4298..4402
                     /label=AmpR promoter
     CDS             4403..5260
                     /label=AmpR
                     /note="beta-lactamase"
     rep_origin      5434..6022
                     /label=ori
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of 
                     replication"
     repeat_region   6084..6213
                     /label=AAV2 ITR (alternate)
                     /note="AAV2 ITR (alternate)"
                     /note="Functional equivalent of wild-type AAV2 ITR"
     promoter        6313
                     /label=EF-1-alpha promoter
                     /note="strong constitutive promoter for human elongation
                     factor EF-1-alpha"