pLKO.1-TRC vector (V012791)

MSDS

Basic Vector Information

This is the recommended vector for cloning and expressing new shRNA sequences. This plasmid is being used by The RNAi Consortium to produce their shRNA library http://www.broad.mit.edu/genome_bio/trc/ The 1.9kb stuffer can be released with AgeI and EcoRI and replaced with your shRNA sequence of choice.

Vector Name:: pLKO.1-TRC

Antibiotic Resistance:: Ampicillin

Length:: 8901 bp

Type:: RNAi

Replication origin:: ori

Source/Author:: David Root

Copy Number:: High copy number

Promoter:: hPGK

Cloning Method:: Enzyme Cut

5' Primer:: LKO.15' ：GACTATCATATGCTTACCGT

Expression Method:: Constiutive, Stable / Transient

pLKO.1-TRC vector Vector Map

Plasmid Resuspension Protocol:

1. Centrifuge at 5,000×g for 5 min.

2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.

3. Close the tube and incubate for 10 minutes at room temperature.

4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.

5.Store the plasmid at -20 ℃.

pLKO.1-TRC vector Sequence

Copy Sequence

Download GeneBank File(.gb)

LOCUS       pLKO.1-TRC.        8901 bp DNA     circular SYN 13-DEC-2021
DEFINITION  synthetic circular DNA.
ACCESSION   .
VERSION     .
KEYWORDS    pLKO.1-TRC.
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 8901)
  TITLE     Direct Submission
REFERENCE   2  (bases 1 to 8901)
  AUTHORS   .
  TITLE     Direct Submission
COMMENT     SGRef: number: 1; type: "Journal Article"
FEATURES             Location/Qualifiers
     source          1..8901
                     /mol_type="other DNA"
                     /organism="synthetic DNA construct"
     promoter        7..507
                     /label=hPGK promoter
                     /note="human phosphoglycerate kinase 1 promoter"
     CDS             529..1125
                     /label=PuroR
                     /note="puromycin N-acetyltransferase"
     LTR             1256..1489
                     /label=3' LTR (Delta-U3)
                     /note="self-inactivating 3' long terminal repeat (LTR) from
                     HIV-1"
     polyA_signal    1561..1695
                     /label=SV40 poly(A) signal
                     /note="SV40 polyadenylation signal"
     rep_origin      1722..1857
                     /label=SV40 ori
                     /note="SV40 origin of replication"
     promoter        complement(1878..1896)
                     /label=T7 promoter
                     /note="promoter for bacteriophage T7 RNA polymerase"
     primer_bind     complement(1906..1922)
                     /label=M13 fwd
                     /note="common sequencing primer, one of multiple similar 
                     variants"
     rep_origin      2064..2519
                     /label=f1 ori
                     /note="f1 bacteriophage origin of replication; arrow
                     indicates direction of (+) strand synthesis"
     promoter        2545..2649
                     /label=AmpR promoter
     CDS             2650..3507
                     /label=AmpR
                     /note="beta-lactamase"
     rep_origin      3681..4269
                     /label=ori
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of 
                     replication"
     protein_bind    4557..4578
                     /label=CAP binding site
                     /note="CAP binding activates transcription in the presence
                     of cAMP."
     promoter        4593..4623
                     /label=lac promoter
                     /note="promoter for the E. coli lac operon"
     protein_bind    4631..4647
                     /label=lac operator
                     /note="The lac repressor binds to the lac operator to
                     inhibit transcription in E. coli. This inhibition can be 
                     relieved by adding lactose or 
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     primer_bind     4655..4671
                     /label=M13 rev
                     /note="common sequencing primer, one of multiple similar 
                     variants"
     promoter        4692..4710
                     /label=T3 promoter
                     /note="promoter for bacteriophage T3 RNA polymerase"
     promoter        4738..4964
                     /label=RSV promoter
                     /note="Rous sarcoma virus enhancer/promoter"
     LTR             4965..5145
                     /label=5' LTR (truncated)
                     /note="truncated 5' long terminal repeat (LTR) from HIV-1"
     misc_feature    5192..5317
                     /label=HIV-1 Psi
                     /note="packaging signal of human immunodeficiency virus
                     type 1"
     misc_feature    5810..6043
                     /label=RRE
                     /note="The Rev response element (RRE) of HIV-1 allows for 
                     Rev-dependent mRNA export from the nucleus to the 
                     cytoplasm."
     CDS             6228..6272
                     /label=gp41 peptide
                     /note="antigenic peptide corresponding to amino acids 655
                     to 669 of the HIV envelope protein gp41 (Lutje Hulsik et 
                     al., 2013)"
     CDS             6421..6462
                     /note="Protein Tat from Human immunodeficiency virus type 1
                     group M subtype B (isolate WMJ22). Accession#: P12509"
     promoter        6570..6810
                     /label=U6 promoter
                     /note="RNA polymerase III promoter for human U6 snRNA"
     misc_feature    6822..8690
                     /label=stuffer
                     /note="stuffer"
     misc_feature    8732..8849
                     /label=cPPT/CTS
                     /note="central polypurine tract and central termination
                     sequence of HIV-1"
     promoter        8898..8901
                     /label=hPGK promoter
                     /note="human phosphoglycerate kinase 1 promoter"

This page is informational only.