Cart 2

pBAD24 vector (V012783#)

Basic Vector Information

Basic Vector Information
Vector Name pBAD24 Antibiotic Resistance Ampicillin
Length 4542 bp Type E.coli expression plasmid
Source Beckwith Lab Copy Number High copy number
Promoter araBAD promoter Cloning Method Enzyme Cut
5' Primer pBAD-F: ATGCCATAGCATTTTTATCC 3' Primer pBAD-R: gatttaatctgtatcagg
Expression Method L-arabinose Induced

pBAD24 vector Vector Map

araC araBAD rrnB T1 terminator rrnB T2 terminator bla bla f1 ori ori

pBAD24 vector Sequence

Copy Sequence

Download GeneBank File(.gb)

LOCUS       Exported                4542 bp ds-DNA     circular SYN 22-SEP-2021
DEFINITION  synthetic circular DNA
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 4542)
  TITLE     Direct Submission
FEATURES             Location/Qualifiers
     source          1..4542
                     /organism="synthetic DNA construct"
                     /mol_type="other DNA"
     CDS             complement(96..974)
                     /product="L-arabinose regulatory protein"
     promoter        1001..1285
                     /note="araBAD promoter"
                     /note="promoter of the L-arabinose operon of E. coli; the 
                     araC regulatory gene is transcribed in the opposite 
                     direction (Guzman et al., 1995)"
     terminator      1569..1655
                     /gene="Escherichia coli rrnB"
                     /note="rrnB T1 terminator"
                     /note="transcription terminator T1 from the E. coli rrnB 
     terminator      1747..1774
                     /note="rrnB T2 terminator"
                     /note="transcription terminator T2 from the E. coli rrnB 
     promoter        1793..1884
                     /note="AmpR promoter"
     CDS             1885..2745
                     /note="confers resistance to ampicillin, carbenicillin, and
                     related antibiotics"
     rep_origin      2787..3242
                     /note="f1 ori"
                     /note="f1 bacteriophage origin of replication; arrow 
                     indicates direction of (+) strand synthesis"
     rep_origin      3353..3941
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of 

This page is informational only.