Cart 2

pBAD33 vector (V012782#)

Basic Vector Information

Basic Vector Information
Vector Name pBAD33 Antibiotic Resistance Chloramphenicol
Length 5352 bp Type E.coli expression plasmid
Source Beckwith Lab Copy Number High copy number
Promoter araBAD promoter Cloning Method Enzyme Cut
5' Primer pBAD-F: ATGCCATAGCATTTTTATCC 3' Primer pBAD-R: gatttaatctgtatcagg
Expression Method L-arabinose Induced

pBAD33 vector Vector Map

araC araBAD MCS rrnB T1 terminator rrnB T2 terminator bla f1 ori cat cat promoter p15A ori

pBAD33 vector Sequence

Copy Sequence

Download GeneBank File(.gb)

LOCUS       Exported                5352 bp ds-DNA     circular SYN 22-SEP-2021
DEFINITION  synthetic circular DNA
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 5352)
  TITLE     Direct Submission
FEATURES             Location/Qualifiers
     source          1..5352
                     /organism="synthetic DNA construct"
                     /mol_type="other DNA"
     CDS             complement(96..974)
                     /product="L-arabinose regulatory protein"
     promoter        1001..1285
                     /note="araBAD promoter"
                     /note="promoter of the L-arabinose operon of E. coli; the 
                     araC regulatory gene is transcribed in the opposite 
                     direction (Guzman et al., 1995)"
     misc_feature    1306..1362
                     /note="pUC18/19 multiple cloning site"
     terminator      1565..1651
                     /gene="Escherichia coli rrnB"
                     /note="rrnB T1 terminator"
                     /note="transcription terminator T1 from the E. coli rrnB 
     terminator      1743..1770
                     /note="rrnB T2 terminator"
                     /note="transcription terminator T2 from the E. coli rrnB 
     promoter        1789..1880
                     /note="AmpR promoter"
     rep_origin      2334..2789
                     /note="f1 ori"
                     /note="f1 bacteriophage origin of replication; arrow 
                     indicates direction of (+) strand synthesis"
     CDS             complement(3344..4003)
                     /product="chloramphenicol acetyltransferase"
                     /note="confers resistance to chloramphenicol"
     promoter        complement(4004..4106)
                     /note="cat promoter"
                     /note="promoter of the E. coli cat gene encoding 
                     chloramphenicol acetyltransferase"
     rep_origin      complement(4632..5177)
                     /note="p15A ori"
                     /note="Plasmids containing the medium-copy-number p15A 
                     origin of replication can be propagated in E. coli cells 
                     that contain a second plasmid with the ColE1 origin."

This page is informational only.