Cart 2

pBAD43 vector (V012781#)

Basic Vector Information

Basic Vector Information
Vector Name pBAD43 Antibiotic Resistance Spectinomycin
Length 6179 bp Type E.coli expression plasmid
Source Beckwith Lab Copy Number High copy number
Promoter araBAD promoter Cloning Method Enzyme Cut
5' Primer pBAD-F: ATGCCATAGCATTTTTATCC 3' Primer pBAD-R: gatttaatctgtatcagg
Expression Method L-arabinose Induced

pBAD43 vector Vector Map

araC araBAD rrnB T1 terminator rrnB T2 terminator M13 fwd SmR rep101 pSC101 ori CAP binding site lac promoter

pBAD43 vector Sequence

Copy Sequence

Download GeneBank File(.gb)

LOCUS       Exported                6179 bp ds-DNA     circular SYN 22-SEP-2021
DEFINITION  synthetic circular DNA
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 6179)
  TITLE     Direct Submission
FEATURES             Location/Qualifiers
     source          1..6179
                     /organism="synthetic DNA construct"
                     /mol_type="other DNA"
     CDS             complement(191..1069)
                     /product="L-arabinose regulatory protein"
     promoter        1096..1380
                     /note="araBAD promoter"
                     /note="promoter of the L-arabinose operon of E. coli; the 
                     araC regulatory gene is transcribed in the opposite 
                     direction (Guzman et al., 1995)"
     terminator      1664..1750
                     /gene="Escherichia coli rrnB"
                     /note="rrnB T1 terminator"
                     /note="transcription terminator T1 from the E. coli rrnB 
     terminator      1842..1869
                     /note="rrnB T2 terminator"
                     /note="transcription terminator T2 from the E. coli rrnB 
     primer_bind     complement(1950..1966)
                     /note="M13 fwd"
                     /note="common sequencing primer, one of multiple similar 
     CDS             complement(2489..3280)
                     /product="aminoglycoside adenylyltransferase (Murphy, 
                     /note="confers resistance to spectinomycin and 
     CDS             complement(4314..5264)
                     /product="RepA protein needed for replication with the 
                     pSC101 origin"
     rep_origin      5312..5534
                     /note="pSC101 ori"
                     /note="low-copy replication origin that requires the Rep101
     protein_bind    6099..6120
                     /bound_moiety="E. coli catabolite activator protein"
                     /note="CAP binding site"
                     /note="CAP binding activates transcription in the presence 
                     of cAMP."
     promoter        6135..6165
                     /note="lac promoter"
                     /note="promoter for the E. coli lac operon"

This page is informational only.