Price Information
| Cat No. | Plasmid Name | Availability | Buy one, get one free! (?) |
|---|---|---|---|
| V012765 | pWPXL | In stock, instant shipping |
Two tubes of lyophilized plasmid will be delivered, each tube is about 5µg.
Basic Vector Information
2nd generation lentiviral transfer plasmid
- Vector Name:
- pWPXL
- Antibiotic Resistance:
- Ampicillin
- Length:
- 10538 bp
- Type:
- Viral Expression & Packaging Vectors
- Replication origin:
- ori
- Source/Author:
- Didier Trono
- Selection Marker:
- EGFP
- Copy Number:
- High copy number
- Promoter:
- EF1A
- Cloning Method:
- Enzyme Cut
- 5' Primer:
- EF-1a Forward: TCAAGCCTCAGACAGTGGTTC
- 3' Primer:
- EGFP-N: CGTCGCCGTCCAGCTCGACCAG
- Fusion Tag:
- EGFP
- Growth Strain(s):
- stbl3
- Growth Temperature:
- 37℃
- Expression Method:
- Constiutive, Stable / Transient
pWPXL vector Map
Plasmid Protocol
1. Centrifuge at 5,000×g for 5 min.
2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.
5. Store the plasmid at -20 ℃.
6. The concentration of plasmid re-measurement sometimes differs from the nominal value, which may be due to the position of the lyophilized plasmid in the tube, the efficiency of the re-dissolution, the measurement bias, and adsorption on the wall of the tube, therefore, it is recommended to transform and extract the plasmid before using it
General Plasmid Transform Protocol
1. Take one 100μl of the competent cells and thaw it on ice for 10min, add 2μl of plasmid, then ice bath for 30min, then heat-shock it at 42℃ for 60s, do not stir, and then ice bath for 2min.
2. Add 900μl of LB liquid medium without antibiotics, and incubate at 37℃ for 45min (30℃ for 1-1.5 hours) with 180rpm shaking.
3. Centrifuge at 6000rpm for 5min, leave only 100μl of supernatant to resuspend the bacterial precipitate and spread it onto the target plasmid-resistant LB plate.
4. Invert the plate and incubate at 37℃ for 14h, or at 30℃ for 20h.
5. Pick a single colony into LB liquid medium, add the corresponding antibiotics, incubate at 220rpm for 14h, and extract the plasmid according to the experimental needs and the instructions of the plasmid extraction kit.
pWPXL vector Sequence
LOCUS pWPXL 10538 bp DNA circular SYN 20-JUL-2025
DEFINITION Exported.
ACCESSION V012765
VERSION .
KEYWORDS pWPXL
SOURCE synthetic DNA construct
ORGANISM synthetic DNA construct
REFERENCE 1 (bases 1 to 10538)
TITLE Direct Submission
REFERENCE 2 (bases 1 to 10538)
TITLE Direct Submission
REFERENCE 3 (bases 1 to 10538)
AUTHORS .
TITLE Direct Submission
COMMENT SGRef: number: 1; type: "Journal Article"
COMMENT SGRef: number: 2; type: "Journal Article"
FEATURES Location/Qualifiers
source 1..10538
/mol_type="other DNA"
/organism="synthetic DNA construct"
source 2025..2049
/mol_type="other DNA"
/organism="synthetic DNA construct"
LTR 2..635
/label=3' LTR
/note="3' long terminal repeat (LTR) from HIV-1"
misc_feature 682..807
/label=HIV-1 Psi
/note="packaging signal of human immunodeficiency virus
type 1"
misc_feature 1300..1533
/label=RRE
/note="The Rev response element (RRE) of HIV-1 allows for
Rev-dependent mRNA export from the nucleus to the
cytoplasm."
CDS 1718..1762
/label=gp41 peptide
/note="antigenic peptide corresponding to amino acids 655
to 669 of the HIV envelope protein gp41 (Lutje Hulsik et
al., 2013)"
CDS 1911..1952
/label=Protein Tat
/note="Protein Tat from Human immunodeficiency virus type 1
group M subtype B (isolate WMJ22). Accession#: P12509"
promoter 2145..3323
/label=EF-1-alpha promoter
/note="strong constitutive promoter for human elongation
factor EF-1-alpha"
misc_feature 3371..3487
/label=cPPT/CTS
/note="central polypurine tract and central termination
sequence of HIV-1"
CDS 3571..4287
/label=EGFP
/note="enhanced GFP"
misc_feature 4369..4957
/label=WPRE
/note="woodchuck hepatitis virus posttranscriptional
regulatory element"
protein_bind complement(5101..5134)
/label=loxP
/note="Cre-mediated recombination occurs in the 8-bp core
sequence (ATGTATGC) (Shaw et al., 2021)."
LTR 5154..5334
/label=5' LTR (truncated)
/note="5' LTR (truncated)"
/note="truncated 5' long terminal repeat (LTR) from HIV-1"
promoter complement(5359..5377)
/label=SP6 promoter
/note="promoter for bacteriophage SP6 RNA polymerase"
promoter 6165..6269
/label=AmpR promoter
CDS 6270..7127
/label=AmpR
/note="beta-lactamase"
rep_origin 7301..7889
/direction=RIGHT
/label=ori
/note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
replication"
promoter 8135..8464
/label=SV40 promoter
/note="SV40 enhancer and early promoter"
intron 9598..9663
/label=small t intron
/note="SV40 (simian virus 40) small t antigen intron"
CDS 9793..9813
/label=SV40 NLS
/note="nuclear localization signal of SV40 (simian virus
40) large T antigen"
polyA_signal 10238..10372
/label=SV40 poly(A) signal
/note="SV40 polyadenylation signal"