Cart 2

pTrc99a vector (V012683#)

Basic Vector Information

Tightly regulated tac promoter vectors useful for the expression of unfused and fused proteins in Escherichia coli

Basic Vector Information
Vector Name pTrc99a Antibiotic Resistance Ampicillin
Length 4176 bp Type Bacterial expression vector
Copy Number High copy number Promoter trc
Cloning Method Enzyme Cut 5' Primer GAGCGGATAACAATTTCACACAGG
3' Primer GATTTAATCTGTATCAGG Expression Method IPTG induced

pTrc99a vector Vector Map

pTrc99a vector Sequence

Copy Sequence

Download SnapGene Map(.dna)

Download GeneBank File(.gb)

LOCUS       Exported                4176 bp ds-DNA     circular SYN 09-DEC-2020
DEFINITION  synthetic circular DNA
KEYWORDS    pTrc99a
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 4176)
  AUTHORS   caoheibi
  TITLE     Direct Submission
  JOURNAL   Exported Wednesday, December 9, 2020 from SnapGene 3.2.1
FEATURES             Location/Qualifiers
     source          1..4176
                     /organism="synthetic DNA construct"
                     /mol_type="other DNA"
     misc_feature    193..222
                     /note="trc promoter"
                     /note="strong E. coli promoter; hybrid between the trp and 
                     lac UV5 promoters"
     protein_bind    230..246
                     /bound_moiety="lac repressor encoded by lacI"
                     /note="lac operator"
                     /note="The lac repressor binds to the lac operator to 
                     inhibit transcription in E. coli. This inhibition can be 
                     relieved by adding lactose or 
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     misc_feature    270..326
                     /note="pUC18/19 multiple cloning site"
     terminator      529..615
                     /gene="Escherichia coli rrnB"
                     /note="rrnB T1 terminator"
                     /note="transcription terminator T1 from the E. coli rrnB 
     terminator      707..734
                     /note="rrnB T2 terminator"
                     /note="transcription terminator T2 from the E. coli rrnB 
     promoter        754..845
                     /note="AmpR promoter"
     CDS             846..1706
                     /note="confers resistance to ampicillin, carbenicillin, and
                     related antibiotics"
     rep_origin      1877..2465
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of 
     misc_feature    2651..2791
                     /note="basis of mobility region from pBR322"
     promoter        2977..3054
                     /gene="lacI (mutant)"
                     /note="lacIq promoter"
                     /note="In the lacIq allele, a single base change in the 
                     promoter boosts expression of the lacI gene about 10-fold."
     CDS             3055..4137
                     /product="lac repressor"
                     /note="The lac repressor binds to the lac operator to 
                     inhibit transcription in E. coli. This inhibition can be 
                     relieved by adding lactose or 
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."

This page is informational only.