Price Information
Cat No. | Plasmid Name | Availability | Add to cart |
---|---|---|---|
V012682 | pLVX-EF1α-IRES-mCherry | In stock (lyophilized plasmid) |
Buy one, get one free! |
Two vials of lyophilized plasmid will be delivered, each vial is about 5µg.
Basic Vector Information
pLVX-EF1α-IRES-mCherry is a lentiviral bicistronic expression vector for constitutively co-expressing a protein of interest. It includes a mCherry from the EF-1α promoter.
- Vector Name:
- pLVX-EF1α-IRES-mCherry
- Antibiotic Resistance:
- Ampicillin
- Length:
- 8904 bp
- Type:
- Viral Expression & Packaging Vectors
- Replication origin:
- ori
- Source/Author:
- Clontech
- Selection Marker:
- mCherry
- Copy Number:
- High copy number
- Promoter:
- EF-1α
- Cloning Method:
- Enzyme Cut
- 5' Primer:
- EF1a Forward: TCAAGCCTCAGACAGTGGTTC
- 3' Primer:
- IRES-R: CCTCACATTGCCAAAAGACG
- Growth Strain(s):
- stbl3
- Growth Temperature:
- 37℃
- Expression Method:
- Constiutive, Stable
pLVX-EF1α-IRES-mCherry vector Vector Map
Plasmid Resuspension Protocol:
1. Centrifuge at 5,000×g for 5 min.
2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.
5.Store the plasmid at -20 ℃.
References
- Shi Y, Yuan J, Rraklli V, Maxymovitz E, Cipullo M, Liu M, Li S, Westerlund I, Bedoya-Reina OC, Bullova P, Rorbach J, Juhlin CC, Stenman A, Larsson C, Kogner P, O'Sullivan MJ, Schlisio S, Holmberg J. Aberrant splicing in neuroblastoma generates RNA-fusion transcripts and provides vulnerability to spliceosome inhibitors. Nucleic Acids Res. 2021 Mar 18;49(5):2509-2521.
pLVX-EF1α-IRES-mCherry vector Sequence
LOCUS pLVX-EF1-alpha-I 8904 bp DNA circular SYN 25-NOV-2020 DEFINITION synthetic circular DNA. ACCESSION . VERSION . KEYWORDS pLVX-EF1-alpha-IRES-mCherry. SOURCE synthetic DNA construct ORGANISM synthetic DNA construct REFERENCE 1 (bases 1 to 8904) TITLE Direct Submission REFERENCE 2 (bases 1 to 8904) AUTHORS . TITLE Direct Submission COMMENT SGRef: number: 1; type: "Journal Article" FEATURES Location/Qualifiers source 1..8904 /mol_type="other DNA" /organism="synthetic DNA construct" LTR 1..634 /label=3' LTR /note="3' long terminal repeat (LTR) from HIV-1" misc_feature 681..806 /label=HIV-1 Psi /note="packaging signal of human immunodeficiency virus type 1" misc_feature 1303..1536 /label=RRE /note="The Rev response element (RRE) of HIV-1 allows for Rev-dependent mRNA export from the nucleus to the cytoplasm." CDS 1721..1765 /label=gp41 peptide /note="antigenic peptide corresponding to amino acids 655 to 669 of the HIV envelope protein gp41 (Lutje Hulsik et al., 2013)" CDS 1914..1955 /note="Protein Tat from Human immunodeficiency virus type 1 group M subtype B (isolate WMJ22). Accession#: P12509" misc_feature 2027..2144 /label=cPPT/CTS /note="central polypurine tract and central termination sequence of HIV-1" promoter 2338..3519 /label=EF-1-alpha promoter /note="strong constitutive promoter for human elongation factor EF-1-alpha" misc_feature 3575..4152 /label=IRES2 /note="internal ribosome entry site (IRES) of the encephalomyocarditis virus (EMCV)" CDS 4149..4856 /label=mCherry /note="monomeric derivative of DsRed fluorescent protein (Shaner et al., 2004)" misc_feature 4873..5461 /label=WPRE /note="woodchuck hepatitis virus posttranscriptional regulatory element" LTR 5668..6301 /label=5' LTR /note="5' long terminal repeat (LTR) from HIV-1" primer_bind complement(6429..6445) /label=M13 rev /note="common sequencing primer, one of multiple similar variants" protein_bind complement(6453..6469) /label=lac operator /note="The lac repressor binds to the lac operator to inhibit transcription in E. coli. This inhibition can be relieved by adding lactose or isopropyl-beta-D-thiogalactopyranoside (IPTG)." promoter complement(6477..6507) /label=lac promoter /note="promoter for the E. coli lac operon" protein_bind complement(6522..6543) /label=CAP binding site /note="CAP binding activates transcription in the presence of cAMP." rep_origin complement(6831..7419) /direction=LEFT /label=ori /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of replication" CDS complement(7593..8450) /label=AmpR /note="beta-lactamase" promoter complement(8451..8555) /label=AmpR promoter polyA_signal 8603..8737 /label=SV40 poly(A) signal /note="SV40 polyadenylation signal"