Price Information
Cat No. | Plasmid Name | Availability | Add to cart |
---|---|---|---|
V012682 | pLVX-EF1α-IRES-mCherry | In stock, instant shipping |
Buy one, get one free! |
Two tubes of lyophilized plasmid will be delivered, each tube is about 5µg.
Basic Vector Information
pLVX-EF1α-IRES-mCherry is a lentiviral bicistronic expression vector for constitutively co-expressing a protein of interest. It includes a mCherry from the EF-1α promoter.
- Vector Name:
- pLVX-EF1α-IRES-mCherry
- Antibiotic Resistance:
- Ampicillin
- Length:
- 8904 bp
- Type:
- Viral Expression & Packaging Vectors
- Replication origin:
- ori
- Source/Author:
- Clontech
- Selection Marker:
- mCherry
- Copy Number:
- High copy number
- Promoter:
- EF-1α
- Cloning Method:
- Enzyme Cut
- 5' Primer:
- EF1a Forward: TCAAGCCTCAGACAGTGGTTC
- 3' Primer:
- IRES-R: CCTCACATTGCCAAAAGACG
- Growth Strain(s):
- stbl3
- Growth Temperature:
- 37℃
- Expression Method:
- Constiutive, Stable
pLVX-EF1α-IRES-mCherry vector Map
Plasmid Protocol
1. Centrifuge at 5,000×g for 5 min.
2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.
5. Store the plasmid at -20 ℃.
6. The concentration of plasmid re-measurement sometimes differs from the nominal value, which may be due to the position of the lyophilized plasmid in the tube, the efficiency of the re-dissolution, the measurement bias, and adsorption on the wall of the tube, therefore, it is recommended to transform and extract the plasmid before using it
General Plasmid Transform Protocol
1. Take one 100μl of the competent cells and thaw it on ice for 10min, add 2μl of plasmid, then ice bath for 30min, then heat-shock it at 42℃ for 60s, do not stir, and then ice bath for 2min.
2. Add 900μl of LB liquid medium without antibiotics, and incubate at 37℃ for 45min (30℃ for 1-1.5 hours) with 180rpm shaking.
3. Centrifuge at 6000rpm for 5min, leave only 100μl of supernatant to resuspend the bacterial precipitate and spread it onto the target plasmid-resistant LB plate.
4. Invert the plate and incubate at 37℃ for 14h, or at 30℃ for 20h.
5. Pick a single colony into LB liquid medium, add the corresponding antibiotics, incubate at 220rpm for 14h, and extract the plasmid according to the experimental needs and the instructions of the plasmid extraction kit.
References
- Shi Y, Yuan J, Rraklli V, Maxymovitz E, Cipullo M, Liu M, Li S, Westerlund I, Bedoya-Reina OC, Bullova P, Rorbach J, Juhlin CC, Stenman A, Larsson C, Kogner P, O'Sullivan MJ, Schlisio S, Holmberg J. Aberrant splicing in neuroblastoma generates RNA-fusion transcripts and provides vulnerability to spliceosome inhibitors. Nucleic Acids Res. 2021 Mar 18;49(5):2509-2521.
pLVX-EF1α-IRES-mCherry vector Sequence
LOCUS V012682 8904 bp DNA circular SYN 25-NOV-2020 DEFINITION Exported. ACCESSION V012682 VERSION V012682 KEYWORDS pLVX-EF1-alpha-IRES-mCherry SOURCE synthetic DNA construct ORGANISM synthetic DNA construct . REFERENCE 1 (bases 1 to 8904) TITLE Direct Submission REFERENCE 2 (bases 1 to 8904) AUTHORS . TITLE Direct Submission COMMENT SGRef: number: 1; type: "Journal Article" FEATURES Location/Qualifiers source 1..8904 /mol_type="other DNA" /organism="synthetic DNA construct" LTR 1..634 /label="3' LTR" /note="3' long terminal repeat (LTR) from HIV-1" misc_feature 681..806 /label="HIV-1 Psi" /note="packaging signal of human immunodeficiency virus type 1" misc_feature 1303..1536 /label="RRE" /note="The Rev response element (RRE) of HIV-1 allows for Rev-dependent mRNA export from the nucleus to the cytoplasm." CDS 1721..1765 /label="gp41 peptide" /note="antigenic peptide corresponding to amino acids 655 to 669 of the HIV envelope protein gp41 (Lutje Hulsik et al., 2013)" CDS 1914..1955 /note="Protein Tat from Human immunodeficiency virus type 1 group M subtype B (isolate WMJ22). Accession#: P12509" /label="Protein Tat" misc_feature 2027..2144 /label="cPPT/CTS" /note="central polypurine tract and central termination sequence of HIV-1" promoter 2338..3519 /label="EF-1-alpha promoter" /note="strong constitutive promoter for human elongation factor EF-1-alpha" misc_feature 3575..4152 /label="IRES2" /note="internal ribosome entry site (IRES) of the encephalomyocarditis virus (EMCV)" CDS 4149..4856 /label="mCherry" /note="monomeric derivative of DsRed fluorescent protein (Shaner et al., 2004)" misc_feature 4873..5461 /label="WPRE" /note="woodchuck hepatitis virus posttranscriptional regulatory element" LTR 5668..6301 /label="5' LTR" /note="5' long terminal repeat (LTR) from HIV-1" primer_bind complement(6429..6445) /label="M13 rev" /note="common sequencing primer, one of multiple similar variants" protein_bind complement(6453..6469) /label="lac operator" /note="The lac repressor binds to the lac operator to inhibit transcription in E. coli. This inhibition can be relieved by adding lactose or isopropyl-beta-D-thiogalactopyranoside (IPTG)." promoter complement(6477..6507) /label="lac promoter" /note="promoter for the E. coli lac operon" protein_bind complement(6522..6543) /label="CAP binding site" /note="CAP binding activates transcription in the presence of cAMP." rep_origin complement(6831..7419) /direction=LEFT /label="ori" /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of replication" CDS complement(7593..8450) /label="AmpR" /note="beta-lactamase" promoter complement(8451..8555) /label="AmpR promoter" polyA_signal 8603..8737 /label="SV40 poly(A) signal" /note="SV40 polyadenylation signal"