Price Information
| Cat No. | Plasmid Name | Availability | Add to cart |
|---|---|---|---|
| V000099 | pCCLc-MND-A0201-Mart1-SABR | In stock, 1 week for quality controls |
Buy one, get one free! |
Two tubes of lyophilized plasmid will be delivered, each tube is about 5µg.
Basic Vector Information
- Vector Name:
- pCCLc-MND-A0201-Mart1-SABR
- Antibiotic Resistance:
- Ampicillin
- Length:
- 9076 bp
- Type:
- Mammalian Expression, Lentiviral
- Replication origin:
- ori
- Selection Marker:
- surface myc-tag
- Copy Number:
- High Copy
- Promoter:
- MND
- 5' Primer:
- GCTCCCCGAGCTCAATAAAAG
- 3' Primer:
- TGGCTAAGATCTACAGCTGCCTT
pCCLc-MND-A0201-Mart1-SABR vector Map
Plasmid Protocol
1. Centrifuge at 5,000×g for 5 min.
2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.
5. Store the plasmid at -20 ℃.
6. The concentration of plasmid re-measurement sometimes differs from the nominal value, which may be due to the position of the lyophilized plasmid in the tube, the efficiency of the re-dissolution, the measurement bias, and adsorption on the wall of the tube, therefore, it is recommended to transform and extract the plasmid before using it
General Plasmid Transform Protocol
1. Take one 100μl of the competent cells and thaw it on ice for 10min, add 2μl of plasmid, then ice bath for 30min, then heat-shock it at 42℃ for 60s, do not stir, and then ice bath for 2min.
2. Add 900μl of LB liquid medium without antibiotics, and incubate at 37℃ for 45min (30℃ for 1-1.5 hours) with 180rpm shaking.
3. Centrifuge at 6000rpm for 5min, leave only 100μl of supernatant to resuspend the bacterial precipitate and spread it onto the target plasmid-resistant LB plate.
4. Invert the plate and incubate at 37℃ for 14h, or at 30℃ for 20h.
5. Pick a single colony into LB liquid medium, add the corresponding antibiotics, incubate at 220rpm for 14h, and extract the plasmid according to the experimental needs and the instructions of the plasmid extraction kit.
pCCLc-MND-A0201-Mart1-SABR vector Sequence
LOCUS V000099 9076 bp DNA circular SYN 13-MAY-2021
DEFINITION Exported.
ACCESSION V000099
VERSION V000099
KEYWORDS pCCLc-MND-A0201-Mart1-SABR
SOURCE synthetic DNA construct
ORGANISM synthetic DNA construct
.
REFERENCE 1 (bases 1 to 9076)
AUTHORS Joglekar AV, Leonard MT, Jeppson JD, Swift M, Li G, Wong S, Peng S,
TITLE T cell antigen discovery via signaling and antigen-presenting
bifunctional receptors
JOURNAL Nature Methods (2019) volume 16, pages 191–198.
REFERENCE 2 (bases 1 to 9076)
TITLE Direct Submission
REFERENCE 3 (bases 1 to 9076)
AUTHORS .
TITLE Direct Submission
COMMENT SGRef: number: 1; type: "Journal Article"; journalName: "Nature
Methods (2019) volume 16, pages 191–198."
SGRef: number: 2; type: "Journal Article"
FEATURES Location/Qualifiers
source 1..9076
/mol_type="other DNA"
/organism="synthetic DNA construct"
primer_bind 17..33
/label="M13 rev"
/note="common sequencing primer, one of multiple similar
variants"
promoter 54..72
/label="T3 promoter"
/note="promoter for bacteriophage T3 RNA polymerase"
enhancer 173..552
/label="CMV enhancer"
/note="human cytomegalovirus immediate early enhancer"
promoter 553..756
/label="CMV promoter"
/note="human cytomegalovirus (CMV) immediate early
promoter"
LTR 771..951
/label="5' LTR (truncated)"
/note="truncated 5' long terminal repeat (LTR) from HIV-1"
misc_feature 998..1123
/label="HIV-1 Psi"
/note="packaging signal of human immunodeficiency virus
type 1"
misc_feature 1616..1849
/label="RRE"
/note="The Rev response element (RRE) of HIV-1 allows for
Rev-dependent mRNA export from the nucleus to the
cytoplasm."
CDS 2034..2078
/label="gp41 peptide"
/note="antigenic peptide corresponding to amino acids 655
to 669 of the HIV envelope protein gp41 (Lutje Hulsik et
al., 2013)"
CDS 2227..2268
/note="Protein Tat from Human immunodeficiency virus type 1
group M subtype B (isolate WMJ22). Accession#: P12509"
/label="Protein Tat"
misc_feature 2375..2492
/label="cPPT/CTS"
/note="central polypurine tract and central termination
sequence of HIV-1"
promoter 2538..3075
/label="MNDU3"
/note="The U3 region from the myeloproliferative sarcoma
virus (MPSV) LTR with the negative control region (NCR)
removed"
sig_peptide 3095..3172
/label="hGH signal sequence"
/note="human growth hormone signal sequence"
CDS 5132..5197
/label="F2A"
/note="2A peptide from foot-and-mouth disease virus
polyprotein"
CDS 5282..5311
/codon_start=1
/product="Myc (human c-Myc proto-oncogene) epitope tag"
/label="Myc"
/translation="EQKLISEEDL"
LTR 5694..5927
/label="3' LTR (Delta-U3)"
/note="self-inactivating 3' long terminal repeat (LTR) from
HIV-1"
polyA_signal 5999..6133
/label="SV40 poly(A) signal"
/note="SV40 polyadenylation signal"
rep_origin 6160..6295
/label="SV40 ori"
/note="SV40 origin of replication"
promoter complement(6316..6334)
/label="T7 promoter"
/note="promoter for bacteriophage T7 RNA polymerase"
primer_bind complement(6344..6360)
/label="M13 fwd"
/note="common sequencing primer, one of multiple similar
variants"
rep_origin 6502..6957
/label="f1 ori"
/note="f1 bacteriophage origin of replication; arrow
indicates direction of (+) strand synthesis"
promoter 6983..7087
/label="AmpR promoter"
CDS 7088..7945
/label="AmpR"
/note="beta-lactamase"
rep_origin 8119..8707
/label="ori"
/note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
replication"
primer_bind 8861..8878
/label="L4440"
/note="L4440 vector, forward primer"
protein_bind 8995..9016
/label="CAP binding site"
/note="CAP binding activates transcription in the presence
of cAMP."
promoter 9031..9061
/label="lac promoter"
/note="promoter for the E. coli lac operon"