Price Information
Cat No. | Plasmid Name | Availability | Add to cart |
---|---|---|---|
V000078 | pLOX-CW-CRE | In stock, 1 week for quality controls |
Buy one, get one free! |
Two tubes of lyophilized plasmid will be delivered, each tube is about 5µg.
Basic Vector Information
Cloning host is Stbl3 or HB101
- Vector Name:
- pLOX-CW-CRE
- Antibiotic Resistance:
- Ampicillin
- Length:
- 9886 bp
- Type:
- Lentiviral vectors
- Replication origin:
- ori
- Copy Number:
- High copy number
- Promoter:
- CMV
- Cloning Method:
- Enzyme digestion and ligation
- 5' Primer:
- CMV forward : CGCAAATGGGCGGTAGGCGTG
- 3' Primer:
- SP6 : ATTTAGGTGACACTATAG
pLOX-CW-CRE vector Vector Map
Plasmid Protocol
1. Centrifuge at 5,000×g for 5 min.
2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.
5. Store the plasmid at -20 ℃.
6. The concentration of plasmid re-measurement sometimes differs from the nominal value, which may be due to the position of the lyophilized plasmid in the tube, the efficiency of the re-dissolution, the measurement bias, and adsorption on the wall of the tube, therefore, it is recommended to transform and extract the plasmid before using it
General Plasmid Transform Protocol
1. Take one 100μl of the competent cells and thaw it on ice for 10min, add 2μl of plasmid, then ice bath for 30min, then heat-shock it at 42℃ for 60s, do not stir, and then ice bath for 2min.
2. Add 900μl of LB liquid medium without antibiotics, and incubate at 37℃ for 45min (30℃ for 1-1.5 hours) with 180rpm shaking.
3. Centrifuge at 6000rpm for 5min, leave only 100μl of supernatant to resuspend the bacterial precipitate and spread it onto the target plasmid-resistant LB plate.
4. Invert the plate and incubate at 37℃ for 14h, or at 30℃ for 20h.
5. Pick a single colony into LB liquid medium, add the corresponding antibiotics, incubate at 220rpm for 14h, and extract the plasmid according to the experimental needs and the instructions of the plasmid extraction kit.
pLOX-CW-CRE vector Sequence
LOCUS V000078 9886 bp DNA circular SYN 13-JAN-2022 DEFINITION Exported. ACCESSION V000078 VERSION V000078 KEYWORDS . SOURCE synthetic DNA construct ORGANISM synthetic DNA construct . REFERENCE 1 (bases 1 to 9886) TITLE Direct Submission REFERENCE 2 (bases 1 to 9886) AUTHORS . TITLE Direct Submission COMMENT SGRef: number: 1; type: "Journal Article" FEATURES Location/Qualifiers source 1..9886 /mol_type="other DNA" /organism="synthetic DNA construct" LTR 4..637 /label="3' LTR" /note="3' long terminal repeat (LTR) from HIV-1" misc_feature 684..809 /label="HIV-1 Psi" /note="packaging signal of human immunodeficiency virus type 1" misc_feature 1302..1535 /label="RRE" /note="The Rev response element (RRE) of HIV-1 allows for Rev-dependent mRNA export from the nucleus to the cytoplasm." CDS 1720..1764 /label="gp41 peptide" /note="antigenic peptide corresponding to amino acids 655 to 669 of the HIV envelope protein gp41 (Lutje Hulsik et al., 2013)" CDS 1913..1954 /note="Protein Tat from Human immunodeficiency virus type 1 group M subtype B (isolate WMJ22). Accession#: P12509" /label="Protein Tat" enhancer 2043..2346 /label="CMV enhancer" /note="human cytomegalovirus immediate early enhancer" promoter 2347..2550 /label="CMV promoter" /note="human cytomegalovirus (CMV) immediate early promoter" CDS 2643..2663 /codon_start=1 /product="nuclear localization signal of SV40 large T antigen" /label="nuclear localization signal of SV40 large T ant" /note="SV40 NLS" /translation="PKKKRKV" CDS 2661..3689 /label="Cre" /note="site-specific recombinase" misc_feature 3718..4306 /label="WPRE" /note="woodchuck hepatitis virus posttranscriptional regulatory element" protein_bind complement(4450..4483) /label="loxP" /note="Cre-mediated recombination occurs in the 8-bp core sequence (ATGTATGC) (Shaw et al., 2021)." LTR 4503..4683 /label="5' LTR (truncated)" /note="5' LTR (truncated)" /note="truncated 5' long terminal repeat (LTR) from HIV-1" promoter complement(4708..4726) /label="SP6 promoter" /note="promoter for bacteriophage SP6 RNA polymerase" promoter 5514..5618 /label="AmpR promoter" CDS 5619..6476 /label="AmpR" /note="beta-lactamase" rep_origin 6650..7238 /direction=RIGHT /label="ori" /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of replication" promoter 7484..7813 /label="SV40 promoter" /note="SV40 enhancer and early promoter" intron 8947..9012 /label="small t intron" /note="SV40 (simian virus 40) small t antigen intron" CDS 9142..9162 /label="SV40 NLS" /note="nuclear localization signal of SV40 (simian virus 40) large T antigen" polyA_signal 9587..9721 /label="SV40 poly(A) signal" /note="SV40 polyadenylation signal"