Price Information
| Cat No. | Plasmid Name | Availability | Add to cart |
|---|---|---|---|
| V000071 | aMHC-eGFP-Rex-Neo | In stock, 1 week for quality controls |
Buy one, get one free! |
Two tubes of lyophilized plasmid will be delivered, each tube is about 5µg.
Basic Vector Information
- Vector Name:
- aMHC-eGFP-Rex-Neo
- Antibiotic Resistance:
- Ampicillin
- Length:
- 13870 bp
- Type:
- Lentiviral
- Replication origin:
- ori
- Selection Marker:
- Neomycin resistanct marker driven by Rex-1 promoter
- Promoter:
- αMHC(long)
- Cloning Method:
- Restriction Enzyme
- 5' Primer:
- CTTGATGCCGTTCTTCTGCTT - 3' Sequencing only
aMHC-eGFP-Rex-Neo vector Map
Plasmid Protocol
1. Centrifuge at 5,000×g for 5 min.
2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.
5. Store the plasmid at -20 ℃.
6. The concentration of plasmid re-measurement sometimes differs from the nominal value, which may be due to the position of the lyophilized plasmid in the tube, the efficiency of the re-dissolution, the measurement bias, and adsorption on the wall of the tube, therefore, it is recommended to transform and extract the plasmid before using it
General Plasmid Transform Protocol
1. Take one 100μl of the competent cells and thaw it on ice for 10min, add 2μl of plasmid, then ice bath for 30min, then heat-shock it at 42℃ for 60s, do not stir, and then ice bath for 2min.
2. Add 900μl of LB liquid medium without antibiotics, and incubate at 37℃ for 45min (30℃ for 1-1.5 hours) with 180rpm shaking.
3. Centrifuge at 6000rpm for 5min, leave only 100μl of supernatant to resuspend the bacterial precipitate and spread it onto the target plasmid-resistant LB plate.
4. Invert the plate and incubate at 37℃ for 14h, or at 30℃ for 20h.
5. Pick a single colony into LB liquid medium, add the corresponding antibiotics, incubate at 220rpm for 14h, and extract the plasmid according to the experimental needs and the instructions of the plasmid extraction kit.
aMHC-eGFP-Rex-Neo vector Sequence
LOCUS V000071 13870 bp DNA circular SYN 13-MAY-2021
DEFINITION Exported.
ACCESSION V000071
VERSION V000071
KEYWORDS aMHC-eGFP-Rex-Neo
SOURCE synthetic DNA construct
ORGANISM synthetic DNA construct
.
REFERENCE 1 (bases 1 to 13870)
AUTHORS Kita-Matsuo H, Barcova M, Prigozhina N, Salomonis N, Wei K, Jacot
JG, Nelson B, Spiering S, Haverslag R, Kim C, Talantova M, Bajpai R,
Calzolari D, Terskikh A, McCulloch AD, Price JH, Conklin BR, Chen
HS, Mercola M
TITLE Lentiviral vectors and protocols for creation of stable hESC lines
for fluorescent tracking and drug resistance selection of
cardiomyocytes.
JOURNAL PLoS ONE. 2009 . 4(4):e5046.
PUBMED 19352491
REFERENCE 2 (bases 1 to 13870)
TITLE Direct Submission
REFERENCE 3 (bases 1 to 13870)
AUTHORS .
TITLE Direct Submission
COMMENT SGRef: number: 1; type: "Journal Article"; journalName: "PLoS ONE.
2009 . 4(4):e5046."
SGRef: number: 2; type: "Journal Article"
FEATURES Location/Qualifiers
source 1..13870
/mol_type="other DNA"
/organism="synthetic DNA construct"
promoter 27..131
/label="AmpR promoter"
CDS 132..989
/label="AmpR"
/note="beta-lactamase"
rep_origin 1163..1751
/label="ori"
/note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
replication"
primer_bind 1905..1922
/label="L4440"
/note="L4440 vector, forward primer"
protein_bind 2039..2060
/label="CAP binding site"
/note="CAP binding activates transcription in the presence
of cAMP."
promoter 2075..2105
/label="lac promoter"
/note="promoter for the E. coli lac operon"
protein_bind 2113..2129
/label="lac operator"
/bound_moiety="lac repressor encoded by lacI"
/note="The lac repressor binds to the lac operator to
inhibit transcription in E. coli. This inhibition can be
relieved by adding lactose or
isopropyl-beta-D-thiogalactopyranoside (IPTG)."
primer_bind 2118..2140
/label="M13/pUC Reverse"
/note="In lacZ gene"
primer_bind 2137..2153
/label="M13 rev"
/note="common sequencing primer, one of multiple similar
variants"
primer_bind 2137..2153
/label="M13 Reverse"
/note="In lacZ gene. Also called M13-rev"
promoter 2174..2192
/label="T3 promoter"
/note="promoter for bacteriophage T3 RNA polymerase"
promoter 2220..2447
/label="RSV promoter"
/note="Rous sarcoma virus enhancer/promoter"
LTR 2448..2628
/label="5' LTR (truncated)"
/note="truncated 5' long terminal repeat (LTR) from HIV-1"
misc_feature 2672..2797
/label="HIV-1 Psi"
/note="packaging signal of human immunodeficiency virus
type 1"
misc_feature 3290..3523
/label="RRE"
/note="The Rev response element (RRE) of HIV-1 allows for
Rev-dependent mRNA export from the nucleus to the
cytoplasm."
CDS 3708..3752
/label="gp41 peptide"
/note="antigenic peptide corresponding to amino acids 655
to 669 of the HIV envelope protein gp41 (Lutje Hulsik et
al., 2013)"
CDS 3901..3942
/note="Protein Tat from Human immunodeficiency virus type 1
group M subtype B (isolate WMJ22). Accession#: P12509"
/label="Protein Tat"
misc_feature 4019..4135
/label="cPPT/CTS"
/note="central polypurine tract and central termination
sequence of HIV-1"
promoter 4192..9650
/label="alpha-MHC(long)"
/note="Mouse alpha-cardiac myosin heavy chain promoter (5.4
kb)"
CDS 9670..10386
/label="EGFP"
/note="enhanced GFP"
misc_feature 10405..10993
/label="WPRE"
/note="woodchuck hepatitis virus posttranscriptional
regulatory element"
CDS 11735..12535
/label="NeoR/KanR"
/note="aminoglycoside phosphotransferase from Tn5"
LTR 12611..12844
/label="3' LTR (Delta-U3)"
/note="self-inactivating 3' long terminal repeat (LTR) from
HIV-1"
polyA_signal 12916..13050
/label="SV40 poly(A) signal"
/note="SV40 polyadenylation signal"
rep_origin 13056..13191
/label="SV40 ori"
/note="SV40 origin of replication"
promoter complement(13224..13242)
/label="T7 promoter"
/note="promoter for bacteriophage T7 RNA polymerase"
primer_bind complement(13252..13269)
/label="M13 Forward"
/note="In lacZ gene. Also called M13-F20 or M13 (-21)
Forward"
primer_bind complement(13252..13268)
/label="M13 fwd"
/note="common sequencing primer, one of multiple similar
variants"
primer_bind complement(13261..13283)
/label="M13/pUC Forward"
/note="In lacZ gene"
rep_origin 13413..13868
/direction=RIGHT
/label="f1 ori"
/note="f1 bacteriophage origin of replication; arrow
indicates direction of (+) strand synthesis"