pSicoR PGK puro vector (V000021)

Price Information

Cat No. Plasmid Name Availability Add to cart
V000021 pSicoR PGK puro In stock, 1 week for quality controls

Buy one, get one free!

Two tubes of lyophilized plasmid will be delivered, each tube is about 5µg.

Basic Vector Information

Vector Name:
pSicoR PGK puro
Antibiotic Resistance:
Ampicillin
Length:
7696 bp
Type:
Lentiviral vectors
Replication origin:
ori
Selection Marker:
Puromycin
Copy Number:
High copy number
Promoter:
mPGK
Cloning Method:
Enzyme digestion and ligation
5' Primer:
mU6-F:CAGCACAAAAGGAAACTCACC

pSicoR PGK puro vector Vector Map

pSicoR PGK puro7696 bp3006009001200150018002100240027003000330036003900420045004800510054005700600063006600690072007500CMV enhancerCMV promoter5' LTR (truncated)HIV-1 PsiRREgp41 peptideProtein TatcPPT/CTSloxPPGK promoterPuroRloxPWPREKS primer5' LTR (truncated)oriAmpRAmpR promoter

Plasmid Protocol

1. Centrifuge at 5,000×g for 5 min.

2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.

3. Close the tube and incubate for 10 minutes at room temperature.

4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.

5. Store the plasmid at -20 ℃.

6. The concentration of plasmid re-measurement sometimes differs from the nominal value, which may be due to the position of the lyophilized plasmid in the tube, the efficiency of the re-dissolution, the measurement bias, and adsorption on the wall of the tube, therefore, it is recommended to transform and extract the plasmid before using it

General Plasmid Transform Protocol

1. Take one 100μl of the competent cells and thaw it on ice for 10min, add 2μl of plasmid, then ice bath for 30min, then heat-shock it at 42℃ for 60s, do not stir, and then ice bath for 2min.

2. Add 900μl of LB liquid medium without antibiotics, and incubate at 37℃ for 45min (30℃ for 1-1.5 hours) with 180rpm shaking.

3. Centrifuge at 6000rpm for 5min, leave only 100μl of supernatant to resuspend the bacterial precipitate and spread it onto the target plasmid-resistant LB plate.

4. Invert the plate and incubate at 37℃ for 14h, or at 30℃ for 20h.

5. Pick a single colony into LB liquid medium, add the corresponding antibiotics, incubate at 220rpm for 14h, and extract the plasmid according to the experimental needs and the instructions of the plasmid extraction kit.

pSicoR PGK puro vector Sequence

Copy Sequence

Download GeneBank File(.gb)

LOCUS       V000021                 7696 bp    DNA     circular SYN 13-JAN-2022
DEFINITION  Exported.
ACCESSION   V000021
VERSION     V000021
KEYWORDS    .
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
            .
REFERENCE   1  (bases 1 to 7696)
  TITLE     Direct Submission
REFERENCE   2  (bases 1 to 7696)
  AUTHORS   .
  TITLE     Direct Submission
COMMENT     SGRef: number: 1; type: "Journal Article"
FEATURES             Location/Qualifiers
     source          1..7696
                     /mol_type="other DNA"
                     /organism="synthetic DNA construct"
     enhancer        247..626
                     /label="CMV enhancer"
                     /note="human cytomegalovirus immediate early enhancer"
     promoter        627..829
                     /label="CMV promoter"
                     /note="human cytomegalovirus (CMV) immediate early
                     promoter"
     LTR             844..1024
                     /label="5' LTR (truncated)"
                     /note="5' LTR (truncated)"
                     /note="truncated 5' long terminal repeat (LTR) from HIV-1"
     misc_feature    1071..1196
                     /label="HIV-1 Psi"
                     /note="packaging signal of human immunodeficiency virus
                     type 1"
     misc_feature    1695..1928
                     /label="RRE"
                     /note="The Rev response element (RRE) of HIV-1 allows for
                     Rev-dependent mRNA export from the nucleus to the
                     cytoplasm."
     CDS             2113..2157
                     /label="gp41 peptide"
                     /note="antigenic peptide corresponding to amino acids 655
                     to 669 of the HIV envelope protein gp41 (Lutje Hulsik et
                     al., 2013)"
     CDS             2306..2347
                     /note="Protein Tat from Human immunodeficiency virus type 1
                     group M subtype B (isolate WMJ22). Accession#: P12509"
                     /label="Protein Tat"
     misc_feature    2455..2572
                     /label="cPPT/CTS"
                     /note="central polypurine tract and central termination
                     sequence of HIV-1"
     protein_bind    2826..2859
                     /label="Cre recombinase binding site"
                     /bound_moiety="Cre recombinase"
                     /note="loxP"
                     /note="Cre-mediated recombination occurs in the 8-bp core
                     sequence (GCATACAT)."
     promoter        3008..3507
                     /label="PGK promoter"
                     /note="mouse phosphoglycerate kinase 1 promoter"
     CDS             3551..4147
                     /label="PuroR"
                     /note="puromycin N-acetyltransferase"
     protein_bind    complement(4496..4529)
                     /label="loxP"
                     /note="Cre-mediated recombination occurs in the 8-bp core
                     sequence (ATGTATGC) (Shaw et al., 2021)."
     misc_feature    4585..5173
                     /label="WPRE"
                     /note="woodchuck hepatitis virus posttranscriptional
                     regulatory element"
     primer_bind     complement(5176..5192)
                     /label="KS primer"
                     /note="common sequencing primer, one of multiple similar
                     variants"
     LTR             5702..5882
                     /label="5' LTR (truncated)"
                     /note="truncated 5' long terminal repeat (LTR) from HIV-1"
     rep_origin      complement(5944..6532)
                     /direction=LEFT
                     /label="ori"
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
                     replication"
     CDS             complement(6706..7563)
                     /label="AmpR"
                     /note="beta-lactamase"
     promoter        complement(7564..7668)
                     /label="AmpR promoter"