pEVOL-pBpF vector (V012597) Gene synthesis in pEVOL-pBpF backbone

Price Information

Cat No. Plasmid Name Availability Buy one, get one free! (?)
V012597 pEVOL-pBpF In stock, instant shipping

Two tubes of lyophilized plasmid will be delivered, each tube is about 5µg.

Basic Vector Information

The ​pEVOL-pBpF​ plasmid enables site-specific incorporation of the ​non-canonical amino acid (UAA) para-benzoyl-L-phenylalanine (pBpF)​​ into proteins via an orthogonal ​tRNA/synthetase pair. It suppresses the amber (UAG) stop codon, allowing ​photo-crosslinking​ applications for studying protein-protein interactions. Key features include: ​Orthogonal AaRS/tRNA​ for pBpF charging; ​Amber codon suppression​ for UAA insertion; ​UV-activatable pBpF​ for covalent crosslinking.

Vector Name:
pEVOL-pBpF
Antibiotic Resistance:
Chloramphenicol
Length:
6128 bp
Type:
Bacterial Expression
Replication origin:
p15A ori
Copy Number:
High Copy
Promoter:
araBAD
Cloning Method:
Restriction Enzyme
5' Primer:
ATTAGCGGATCCTACCTGACGCTTTTTATCGCAACTCTCTACTGTTTCTCCATACCCGTTTTTT
Growth Strain(s):
DH10B
Growth Temperature:
37℃

pEVOL-pBpF vector Map

pEVOL-pBpF6128 bp30060090012001500180021002400270030003300360039004200450048005100540057006000araBAD promoterTyrosine--tRNA ligase6xHispBAD ReverseTyrosine--tRNA ligaseCmRcat promoterL4440p15A oriaraC

Plasmid Protocol

1. Centrifuge at 5,000×g for 5 min.

2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.

3. Close the tube and incubate for 10 minutes at room temperature.

4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.

5. Store the plasmid at -20 ℃.

6. The concentration of plasmid re-measurement sometimes differs from the nominal value, which may be due to the position of the lyophilized plasmid in the tube, the efficiency of the re-dissolution, the measurement bias, and adsorption on the wall of the tube, therefore, it is recommended to transform and extract the plasmid before using it

General Plasmid Transform Protocol

1. Take one 100μl of the competent cells and thaw it on ice for 10min, add 2μl of plasmid, then ice bath for 30min, then heat-shock it at 42℃ for 60s, do not stir, and then ice bath for 2min.

2. Add 900μl of LB liquid medium without antibiotics, and incubate at 37℃ for 45min (30℃ for 1-1.5 hours) with 180rpm shaking.

3. Centrifuge at 6000rpm for 5min, leave only 100μl of supernatant to resuspend the bacterial precipitate and spread it onto the target plasmid-resistant LB plate.

4. Invert the plate and incubate at 37℃ for 14h, or at 30℃ for 20h.

5. Pick a single colony into LB liquid medium, add the corresponding antibiotics, incubate at 220rpm for 14h, and extract the plasmid according to the experimental needs and the instructions of the plasmid extraction kit.

References

  • Chin JW, Martin AB, King DS, Wang L, Schultz PG. Addition of a photocrosslinking amino acid to the genetic code of Escherichiacoli. Proc Natl Acad Sci U S A. 2002 Aug 20;99(17):11020-4. doi: 10.1073/pnas.172226299. Epub 2002 Aug 1. PMID: 12154230; PMCID: PMC123203.

pEVOL-pBpF vector Sequence

LOCUS       V012597                 6128 bp    DNA     circular SYN 13-MAY-2021
DEFINITION  Exported.
ACCESSION   V012597
VERSION     V012597
KEYWORDS    pEVOL-pBpF
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
            .
REFERENCE   1  (bases 1 to 6128)
  AUTHORS   Chin JW, Martin AB, King DS, Wang L, Schultz PG
  TITLE     Addition of a photocrosslinking amino acid to the genetic code of
            Escherichiacoli.
  JOURNAL   Proc Natl Acad Sci U S A. 2002 Aug 20;99(17):11020-4. Epub 2002 Aug
            1.
   PUBMED   12154230
REFERENCE   2  (bases 1 to 6128)
  TITLE     Direct Submission
REFERENCE   3  (bases 1 to 6128)
  AUTHORS   .
  TITLE     Direct Submission
COMMENT     SGRef: number: 1; type: "Journal Article"; journalName: "Proc Natl
            Acad Sci U S A."; date: "2002-08-20"; volume: "99(17)"; pages:
            "11020-4. Epub 2002 Aug 1"
            SGRef: number: 2; type: "Journal Article"
FEATURES             Location/Qualifiers
     source          1..6128
                     /mol_type="other DNA"
                     /organism="synthetic DNA construct"
     promoter        22..306
                     /label="araBAD promoter"
                     /note="promoter of the L-arabinose operon of E. coli; the
                     araC regulatory gene is transcribed in the opposite
                     direction (Guzman et al., 1995)"
     CDS             343..1260
                     /gene="tyrS"
                     /label="Tyrosine--tRNA ligase"
                     /note="Tyrosine--tRNA ligase from Methanocaldococcus
                     jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM
                     10045 / NBRC 100440). Accession#: Q57834"
     CDS             1273..1290
                     /label="6xHis"
                     /note="6xHis affinity tag"
     primer_bind     complement(1346..1363)
                     /label="pBAD Reverse"
                     /note="For vectors with E. coli araBAD promoter, reverse
                     primer"
     CDS             1690..2607
                     /gene="tyrS"
                     /label="Tyrosine--tRNA ligase"
                     /note="Tyrosine--tRNA ligase from Methanocaldococcus
                     jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM
                     10045 / NBRC 100440). Accession#: Q57834"
     CDS             complement(3269..3925)
                     /label="CmR"
                     /note="chloramphenicol acetyltransferase"
     promoter        complement(3926..4028)
                     /label="cat promoter"
                     /note="promoter of the E. coli cat gene encoding
                     chloramphenicol acetyltransferase"
     primer_bind     complement(4420..4437)
                     /label="L4440"
                     /note="L4440 vector, forward primer"
     rep_origin      complement(4554..5099)
                     /direction=LEFT
                     /label="p15A ori"
                     /note="Plasmids containing the medium-copy-number p15A
                     origin of replication can be propagated in E. coli cells
                     that contain a second plasmid with the ColE1 origin."
     CDS             complement(5248..6123)
                     /label="araC"
                     /note="L-arabinose regulatory protein"