Price Information
| Cat No. | Plasmid Name | Availability | Add to cart |
|---|---|---|---|
| V012597 | pEVOL-pBpF | In stock, instant shipping |
Buy one, get one free! |
Two tubes of lyophilized plasmid will be delivered, each tube is about 5µg.
Basic Vector Information
- Vector Name:
- pEVOL-pBpF
- Antibiotic Resistance:
- Chloramphenicol
- Length:
- 6128 bp
- Type:
- Bacterial Expression
- Replication origin:
- p15A ori
- Copy Number:
- High Copy
- Promoter:
- araBAD
- Cloning Method:
- Restriction Enzyme
- 5' Primer:
- ATTAGCGGATCCTACCTGACGCTTTTTATCGCAACTCTCTACTGTTTCTCCATACCCGTTTTTT
- Growth Strain(s):
- DH10B
- Growth Temperature:
- 37℃
pEVOL-pBpF vector Vector Map
Plasmid Protocol
1. Centrifuge at 5,000×g for 5 min.
2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.
5. Store the plasmid at -20 ℃.
6. The concentration of plasmid re-measurement sometimes differs from the nominal value, which may be due to the position of the lyophilized plasmid in the tube, the efficiency of the re-dissolution, the measurement bias, and adsorption on the wall of the tube, therefore, it is recommended to transform and extract the plasmid before using it
General Plasmid Transform Protocol
1. Take one 100μl of the competent cells and thaw it on ice for 10min, add 2μl of plasmid, then ice bath for 30min, then heat-shock it at 42℃ for 60s, do not stir, and then ice bath for 2min.
2. Add 900μl of LB liquid medium without antibiotics, and incubate at 37℃ for 45min (30℃ for 1-1.5 hours) with 180rpm shaking.
3. Centrifuge at 6000rpm for 5min, leave only 100μl of supernatant to resuspend the bacterial precipitate and spread it onto the target plasmid-resistant LB plate.
4. Invert the plate and incubate at 37℃ for 14h, or at 30℃ for 20h.
5. Pick a single colony into LB liquid medium, add the corresponding antibiotics, incubate at 220rpm for 14h, and extract the plasmid according to the experimental needs and the instructions of the plasmid extraction kit.
pEVOL-pBpF vector Sequence
LOCUS V012597 6128 bp DNA circular SYN 13-MAY-2021
DEFINITION Exported.
ACCESSION V012597
VERSION V012597
KEYWORDS pEVOL-pBpF
SOURCE synthetic DNA construct
ORGANISM synthetic DNA construct
.
REFERENCE 1 (bases 1 to 6128)
AUTHORS Chin JW, Martin AB, King DS, Wang L, Schultz PG
TITLE Addition of a photocrosslinking amino acid to the genetic code of
Escherichiacoli.
JOURNAL Proc Natl Acad Sci U S A. 2002 Aug 20;99(17):11020-4. Epub 2002 Aug
1.
PUBMED 12154230
REFERENCE 2 (bases 1 to 6128)
TITLE Direct Submission
REFERENCE 3 (bases 1 to 6128)
AUTHORS .
TITLE Direct Submission
COMMENT SGRef: number: 1; type: "Journal Article"; journalName: "Proc Natl
Acad Sci U S A."; date: "2002-08-20"; volume: "99(17)"; pages:
"11020-4. Epub 2002 Aug 1"
SGRef: number: 2; type: "Journal Article"
FEATURES Location/Qualifiers
source 1..6128
/mol_type="other DNA"
/organism="synthetic DNA construct"
promoter 22..306
/label="araBAD promoter"
/note="promoter of the L-arabinose operon of E. coli; the
araC regulatory gene is transcribed in the opposite
direction (Guzman et al., 1995)"
CDS 343..1260
/gene="tyrS"
/label="Tyrosine--tRNA ligase"
/note="Tyrosine--tRNA ligase from Methanocaldococcus
jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM
10045 / NBRC 100440). Accession#: Q57834"
CDS 1273..1290
/label="6xHis"
/note="6xHis affinity tag"
primer_bind complement(1346..1363)
/label="pBAD Reverse"
/note="For vectors with E. coli araBAD promoter, reverse
primer"
CDS 1690..2607
/gene="tyrS"
/label="Tyrosine--tRNA ligase"
/note="Tyrosine--tRNA ligase from Methanocaldococcus
jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM
10045 / NBRC 100440). Accession#: Q57834"
CDS complement(3269..3925)
/label="CmR"
/note="chloramphenicol acetyltransferase"
promoter complement(3926..4028)
/label="cat promoter"
/note="promoter of the E. coli cat gene encoding
chloramphenicol acetyltransferase"
primer_bind complement(4420..4437)
/label="L4440"
/note="L4440 vector, forward primer"
rep_origin complement(4554..5099)
/direction=LEFT
/label="p15A ori"
/note="Plasmids containing the medium-copy-number p15A
origin of replication can be propagated in E. coli cells
that contain a second plasmid with the ColE1 origin."
CDS complement(5248..6123)
/label="araC"
/note="L-arabinose regulatory protein"