Price Information
| Cat No. | Plasmid Name | Availability | Add to cart |
|---|---|---|---|
| V012174 | pX330a dCas9-LSD1 | In stock, 1 week for quality controls |
Buy one, get one free! |
Two tubes of lyophilized plasmid will be delivered, each tube is about 5µg.
Basic Vector Information
- Vector Name:
- pX330a dCas9-LSD1
- Antibiotic Resistance:
- Ampicillin
- Length:
- 10984 bp
- Type:
- Mammalian Expression, CRISPR
- Replication origin:
- ori
- Copy Number:
- High Copy
- Promoter:
- CBh
- Cloning Method:
- Gibson Cloning
- 5' Primer:
- tctgactgaccgcgttactc
- 3' Primer:
- AGGAAAGGACAGTGGGAGTG
pX330a dCas9-LSD1 vector Map
Plasmid Protocol
1. Centrifuge at 5,000×g for 5 min.
2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.
5. Store the plasmid at -20 ℃.
6. The concentration of plasmid re-measurement sometimes differs from the nominal value, which may be due to the position of the lyophilized plasmid in the tube, the efficiency of the re-dissolution, the measurement bias, and adsorption on the wall of the tube, therefore, it is recommended to transform and extract the plasmid before using it
General Plasmid Transform Protocol
1. Take one 100μl of the competent cells and thaw it on ice for 10min, add 2μl of plasmid, then ice bath for 30min, then heat-shock it at 42℃ for 60s, do not stir, and then ice bath for 2min.
2. Add 900μl of LB liquid medium without antibiotics, and incubate at 37℃ for 45min (30℃ for 1-1.5 hours) with 180rpm shaking.
3. Centrifuge at 6000rpm for 5min, leave only 100μl of supernatant to resuspend the bacterial precipitate and spread it onto the target plasmid-resistant LB plate.
4. Invert the plate and incubate at 37℃ for 14h, or at 30℃ for 20h.
5. Pick a single colony into LB liquid medium, add the corresponding antibiotics, incubate at 220rpm for 14h, and extract the plasmid according to the experimental needs and the instructions of the plasmid extraction kit.
pX330a dCas9-LSD1 vector Sequence
LOCUS V012174 10984 bp DNA circular SYN 13-MAY-2021
DEFINITION Exported.
ACCESSION V012174
VERSION V012174
KEYWORDS pX330a dCas9-LSD1
SOURCE synthetic DNA construct
ORGANISM synthetic DNA construct
.
REFERENCE 1 (bases 1 to 10984)
AUTHORS Williams RM, Senanayake U, Artibani M, Taylor G, Wells D, Ahmed AA,
Sauka-Spengler T
TITLE Genome and epigenome engineering CRISPR toolkit for in vivo
modulation of cis-regulatory interactions and gene expression in the
chicken embryo.
JOURNAL Development. 2018 Feb 23;145(4). pii: dev.160333. doi:
10.1242/dev.160333.
PUBMED 29386245
REFERENCE 2 (bases 1 to 10984)
TITLE Direct Submission
REFERENCE 3 (bases 1 to 10984)
AUTHORS .
TITLE Direct Submission
COMMENT SGRef: number: 1; type: "Journal Article"; journalName:
"Development."; date: "2018-02-23"; pages: " 10.1242/dev.160333"
SGRef: number: 2; type: "Journal Article"
FEATURES Location/Qualifiers
source 1..10984
/mol_type="other DNA"
/organism="synthetic DNA construct"
rep_origin 24..612
/label="ori"
/note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
replication"
promoter 674..914
/label="U6 promoter"
/note="RNA polymerase III promoter for human U6 snRNA"
misc_RNA 941..1016
/label="gRNA scaffold"
/note="guide RNA scaffold for the Streptococcus pyogenes
CRISPR/Cas9 system"
enhancer 1113..1398
/label="CMV enhancer"
/note="human cytomegalovirus immediate early enhancer;
contains an 18-bp deletion relative to the standard CMV
enhancer"
promoter 1400..1677
/label="chicken beta-actin promoter"
intron 1678..1906
/label="hybrid intron"
/note="hybrid between chicken beta-actin (CBA) and minute
virus of mice (MMV) introns (Gray et al., 2011)"
CDS 1927..1947
/label="SV40 NLS"
/note="nuclear localization signal of SV40 (simian virus
40) large T antigen"
CDS 1957..6060
/label="Cas9m4"
/note="catalytically dead mutant of the Cas9 endonuclease
from the Streptococcus pyogenes Type II CRISPR/Cas system"
CDS 6073..6093
/codon_start=1
/product="nuclear localization signal of SV40 (simian virus
40) large T antigen"
/label="SV40 NLS"
/translation="PKKKRKV"
CDS 6115..8667
/gene="KDM1A"
/label="Lysine-specific histone demethylase 1A"
/note="Lysine-specific histone demethylase 1A from Homo
sapiens. Accession#: O60341"
polyA_signal 8704..8911
/label="bGH poly(A) signal"
/note="bovine growth hormone polyadenylation signal"
repeat_region 8920..9060
/label="AAV2 ITR"
/note="inverted terminal repeat of adeno-associated virus
serotype 2"
rep_origin 9135..9590
/label="f1 ori"
/note="f1 bacteriophage origin of replication; arrow
indicates direction of (+) strand synthesis"
primer_bind complement(9607..9626)
/label="pRS-marker"
/note="pRS vectors, use to sequence yeast selectable
marker"
primer_bind 9726..9748
/label="pGEX 3'"
/note="pGEX vectors, reverse primer"
primer_bind complement(9786..9804)
/label="pBRforEco"
/note="pBR322 vectors, upsteam of EcoRI site, forward
primer"
promoter 9872..9976
/label="AmpR promoter"
CDS 9977..10834
/label="AmpR"
/note="beta-lactamase"